EMBASSY: VIENNA2: vrnaaliduplex

vrnaaliduplex

Wiki

The master copies of EMBOSS documentation are available at http://emboss.open-bio.org/wiki/Appdocs on the EMBOSS Wiki.

Please help by correcting and extending the Wiki pages.

Function

RNA duplex calculation for two sequence alignments

Description

Reads two alignments of RNA sequences and predicts optimal and suboptimal binding sites, hybridization energies and the corresponding structures. The calculation takes only inter-molecular base pairs into account, for the general case use RNAcofold. The use of alignments allows to focus on binding sites that are evolutionary conserved. Note, that the two input alignments need to have equal number of sequences and the same order, i.e. the 1st sequence in file1 will be hybridized to the 1st in file2 etc. The computed binding sites, energies, and structures are output as one structure per line. Each line consist of: The structure in dot bracket format with a "&" separating the two strands. The range of the structure in the two sequences in the format "from,to : from,to"; the energy of duplex structure in kcal/mol. The format is especially useful for computing the hybrid structure between a small probe sequence and a long target sequence.

Algorithm

RNA secondary structure prediction through energy minimization is the most used function in the Vienna RNA package. Three kinds of dynamic programming algorithms for structure prediction are provided: the minimum free energy algorithm of (Zuker & Stiegler 1981) which yields a single optimal structure, the partition function algorithm of (McCaskill 1990) which calculates base pair probabilities in the thermodynamic ensemble, and the suboptimal folding algorithm of (Wuchty et.al 1999) which generates all suboptimal structures within a given energy range of the optimal energy. For secondary structure comparison, Vienna RNA contains several measures of distance (dissimilarities) using either string alignment or tree-editing (Shapiro & Zhang 1990). Finally, an algorithm to design sequences with a predefined structure (inverse folding) is provided.

Usage

Here is a sample session with vrnaaliduplex

% vrnaaliduplex RNA duplex calculation for two sequence alignments Input (aligned) nucleotide sequence set: rnaaln1.seq Second (aligned) nucleotide sequence set: rnaaln2.seq Vienna RNAfold output file [rnaaln1.vrnaaliduplex]:

Go to the input files for this example
Go to the output files for this example

Command line arguments

RNA duplex calculation for two sequence alignments
Version: EMBOSS:6.6.0.0

   Standard (Mandatory) qualifiers:
  [-asequence]         seqset     (Aligned) nucleotide sequence set filename
                                  and optional format, or reference (input
                                  USA)
  [-bsequence]         seqset     (Aligned) nucleotide sequence set filename
                                  and optional format, or reference (input
                                  USA)
  [-outfile]           outfile    [*.vrnaaliduplex] Vienna RNAfold output file

   Additional (Optional) qualifiers: (none)
   Advanced (Unprompted) qualifiers:
   -paramfile          infile     Vienna RNA parameters file (optional)
   -temperature        float      [37.0] Temperature (Any numeric value)
   -[no]gu             boolean    [Y] Allow GU pairs
   -[no]closegu        boolean    [Y] Allow GU pairs at end of helices
   -[no]lp             boolean    [Y] Allow lonely pairs
   -[no]convert        boolean    [Y] Convert T to U
   -nsbases            string     Non-standard bases (Any string)
   -[no]tetraloop      boolean    [Y] Stabilizing energies for tetra-loops
   -delta              float      [-1.0] Energy range for suboptimal
                                  structures (Any numeric value)
   -sort               boolean    [N] Sort suboptimal structures
   -dangles            menu       [2] Method (Values: 0 (Ignore); 1 (Only
                                  unpaired bases for just one dangling end); 2
                                  (Always use dangling energies); 3 (Allow
                                  coaxial stacking of adjacent helices))

   Associated qualifiers:

   "-asequence" associated qualifiers
   -sbegin1            integer    Start of each sequence to be used
   -send1              integer    End of each sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -scircular1         boolean    Sequence is circular
   -squick1            boolean    Read id and sequence only
   -sformat1           string     Input sequence format
   -iquery1            string     Input query fields or ID list
   -ioffset1           integer    Input start position offset
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name

   "-bsequence" associated qualifiers
   -sbegin2            integer    Start of each sequence to be used
   -send2              integer    End of each sequence to be used
   -sreverse2          boolean    Reverse (if DNA)
   -sask2              boolean    Ask for begin/end/reverse
   -snucleotide2       boolean    Sequence is nucleotide
   -sprotein2          boolean    Sequence is protein
   -slower2            boolean    Make lower case
   -supper2            boolean    Make upper case
   -scircular2         boolean    Sequence is circular
   -squick2            boolean    Read id and sequence only
   -sformat2           string     Input sequence format
   -iquery2            string     Input query fields or ID list
   -ioffset2           integer    Input start position offset
   -sdbname2           string     Database name
   -sid2               string     Entryname
   -ufo2               string     UFO features
   -fformat2           string     Features format
   -fopenfile2         string     Features file name

   "-outfile" associated qualifiers
   -odirectory3        string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write first file to standard output
   -filter             boolean    Read first file from standard input, write
                                  first file to standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options and exit. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages
   -version            boolean    Report version number and exit

Qualifier Type Description Allowed values Default

Standard (Mandatory) qualifiers

[-asequence]
(Parameter 1) seqset (Aligned) nucleotide sequence set filename and optional format, or reference (input USA) Readable set of sequences Required

[-bsequence]
(Parameter 2) seqset (Aligned) nucleotide sequence set filename and optional format, or reference (input USA) Readable set of sequences Required

[-outfile]
(Parameter 3) outfile Vienna RNAfold output file Output file <*>.vrnaaliduplex

Additional (Optional) qualifiers

(none)

Advanced (Unprompted) qualifiers

-paramfile infile Vienna RNA parameters file (optional) Input file Required

-temperature float Temperature Any numeric value 37.0

-[no]gu boolean Allow GU pairs Boolean value Yes/No Yes

-[no]closegu boolean Allow GU pairs at end of helices Boolean value Yes/No Yes

-[no]lp boolean Allow lonely pairs Boolean value Yes/No Yes

-[no]convert boolean Convert T to U Boolean value Yes/No Yes

-nsbases string Non-standard bases Any string

-[no]tetraloop boolean Stabilizing energies for tetra-loops Boolean value Yes/No Yes

-delta float Energy range for suboptimal structures Any numeric value -1.0

-sort boolean Sort suboptimal structures Boolean value Yes/No No

-dangles list Method
0 (Ignore)
1 (Only unpaired bases for just one dangling end)
2 (Always use dangling energies)
3 (Allow coaxial stacking of adjacent helices)
2

Associated qualifiers

"-asequence" associated seqset qualifiers

-sbegin1
-sbegin_asequence integer Start of each sequence to be used Any integer value 0

-send1
-send_asequence integer End of each sequence to be used Any integer value 0

-sreverse1
-sreverse_asequence boolean Reverse (if DNA) Boolean value Yes/No N

-sask1
-sask_asequence boolean Ask for begin/end/reverse Boolean value Yes/No N

-snucleotide1
-snucleotide_asequence boolean Sequence is nucleotide Boolean value Yes/No N

-sprotein1
-sprotein_asequence boolean Sequence is protein Boolean value Yes/No N

-slower1
-slower_asequence boolean Make lower case Boolean value Yes/No N

-supper1
-supper_asequence boolean Make upper case Boolean value Yes/No N

-scircular1
-scircular_asequence boolean Sequence is circular Boolean value Yes/No N

-squick1
-squick_asequence boolean Read id and sequence only Boolean value Yes/No N

-sformat1
-sformat_asequence string Input sequence format Any string

-iquery1
-iquery_asequence string Input query fields or ID list Any string

-ioffset1
-ioffset_asequence integer Input start position offset Any integer value 0

-sdbname1
-sdbname_asequence string Database name Any string

-sid1
-sid_asequence string Entryname Any string

-ufo1
-ufo_asequence string UFO features Any string

-fformat1
-fformat_asequence string Features format Any string

-fopenfile1
-fopenfile_asequence string Features file name Any string

"-bsequence" associated seqset qualifiers

-sbegin2
-sbegin_bsequence integer Start of each sequence to be used Any integer value 0

-send2
-send_bsequence integer End of each sequence to be used Any integer value 0

-sreverse2
-sreverse_bsequence boolean Reverse (if DNA) Boolean value Yes/No N

-sask2
-sask_bsequence boolean Ask for begin/end/reverse Boolean value Yes/No N

-snucleotide2
-snucleotide_bsequence boolean Sequence is nucleotide Boolean value Yes/No N

-sprotein2
-sprotein_bsequence boolean Sequence is protein Boolean value Yes/No N

-slower2
-slower_bsequence boolean Make lower case Boolean value Yes/No N

-supper2
-supper_bsequence boolean Make upper case Boolean value Yes/No N

-scircular2
-scircular_bsequence boolean Sequence is circular Boolean value Yes/No N

-squick2
-squick_bsequence boolean Read id and sequence only Boolean value Yes/No N

-sformat2
-sformat_bsequence string Input sequence format Any string

-iquery2
-iquery_bsequence string Input query fields or ID list Any string

-ioffset2
-ioffset_bsequence integer Input start position offset Any integer value 0

-sdbname2
-sdbname_bsequence string Database name Any string

-sid2
-sid_bsequence string Entryname Any string

-ufo2
-ufo_bsequence string UFO features Any string

-fformat2
-fformat_bsequence string Features format Any string

-fopenfile2
-fopenfile_bsequence string Features file name Any string

"-outfile" associated outfile qualifiers

-odirectory3
-odirectory_outfile string Output directory Any string

General qualifiers

-auto boolean Turn off prompts Boolean value Yes/No N

-stdout boolean Write first file to standard output Boolean value Yes/No N

-filter boolean Read first file from standard input, write first file to standard output Boolean value Yes/No N

-options boolean Prompt for standard and additional values Boolean value Yes/No N

-debug boolean Write debug output to program.dbg Boolean value Yes/No N

-verbose boolean Report some/full command line options Boolean value Yes/No Y

-help boolean Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose Boolean value Yes/No N

-warning boolean Report warnings Boolean value Yes/No Y

-error boolean Report errors Boolean value Yes/No Y

-fatal boolean Report fatal errors Boolean value Yes/No Y

-die boolean Report dying program messages Boolean value Yes/No Y

-version boolean Report version number and exit Boolean value Yes/No N

Input file format

vrnaaliduplex reads any normal sequence USAs.

Input files for usage example

File: rnaaln1.seq

>rna1
CACUACUCCAAGGACCGUAUCUUUCUCAGUGCGACAGUAA
>rna2
---UACUCCAAGGACCGUAUCUUUCUCAGUGCGACAG---

File: rnaaln2.seq

>rna3
UUGGAGUACACAACCUGUACACUCUUUC
>rna4
---GAGUACACAACCUGUACACUCUUUC

Output file format

vrnaaliduplex outputs a graph to the specified graphics device. outputs a report format file. The default format is ...

Output files for usage example

File: rnaaln1.vrnaaliduplex

.((((..((((.&.)))).)))).  27,38  :  14,24  (-7.80)

Data files

None.

Notes

None.

References

Zuker & Stiegler (1981). Nucleic Acids Res. 1981 Jan 10;9(1):133-48 McCaskill (1990). Biopolymers, 29, 1105-19. Wuchty et al (1999). Biopolymers 49(2): 145-165. Shapiro & Zhang (1990). Computer Applications in the Biosciences 6(4): 309-318 (1990)

Warnings

None.

Diagnostic Error Messages

None.

Exit status

It always exits with status 0.

Known bugs

None.

Program name	Description
banana	Plot bending and curvature data for B-DNA
btwisted	Calculate the twisting in a B-DNA sequence
einverted	Find inverted repeats in nucleotide sequences
ovrnaalifold	Calculate secondary structures for a set of aligned RNAs
ovrnaalifoldpf	Calculate secondary structures for a set of aligned RNAs (partition)
ovrnacofold	Calculate secondary structures of RNA dimers
ovrnacofoldconc	Calculate secondary structures of RNA dimers (concentrations)
ovrnacofoldpf	Calculate secondary structures of RNA dimers (partitioning)
ovrnadistance	Calculate distances between RNA secondary structures
ovrnaduplex	Predict RNA duplex (hybridization) sites and structure
ovrnaeval	Calculate energy of RNA sequences with a given secondary structure
ovrnaevalpair	Calculate energy of RNA sequences on given secondary structure
ovrnafold	Calculate min. energy RNA structure / pair probabilities (partition)
ovrnafoldpf	Calculate min. energy RNA structure / pair probabilities
ovrnaheat	Calculate specific heat of RNA melting
ovrnainverse	Find RNA sequences with a given secondary structure
ovrnalfold	Calculate locally stable secondary structures of RNAs
ovrnaplot	Draw RNA secondary structures
ovrnasubopt	Calculate suboptimal secondary structure of RNA
sirna	Find siRNA duplexes in mRNA
vrna2dfold	Calculate RNA structures and samples of k,l neighbourhoods
vrnaalifold	Calculate secondary structures for a set of aligned RNAs
vrnaalifoldpf	Calculate secondary structures for a set of aligned RNAs (partition)
vrnacofold	Calculate secondary structures of RNA dimers
vrnacofoldconc	Calculate secondary structures of RNA dimers (concentrations)
vrnacofoldpf	Calculate secondary structures of RNA dimers (partitioning)
vrnadistance	Calculate distances between RNA secondary structures
vrnaduplex	Predict RNA duplex (hybridization) sites and structure
vrnaeval	Calculate energy of RNA sequences with a given secondary structure
vrnaevalpair	Calculate energy of RNA sequences on given secondary structure
vrnafold	Calculate min. energy RNA secondary structures and pair probabilities
vrnafoldpf	Calculate min. energy RNA structures / pair probabilities (partition)
vrnaheat	Calculate specific heat of RNA melting
vrnainverse	Find RNA sequences with a given secondary structure
vrnalalifoldpf	Calculate secondary structures for a set of aligned RNAs (partition)
vrnalfold	Calculate locally stable secondary structures of RNAs
vrnalfoldz	Calculate locally stable secondary structures of RNAs plus zscore
vrnapkplex	Calculate RNA structures plus pseudoknots
vrnaplfold	Compute avg. pair probabilities for local base pairs in RNA sequences
vrnaplot	Draw RNA secondary structures
vrnasubopt	Calculate suboptimal secondary structures of RNAs

Author(s)

Alan Bleasby
European Bioinformatics Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge CB10 1SD, UK

History

Target users

This program is intended to be used by everyone and everything, from naive users to embedded scripts.

Comments

None

Wiki

Function

Description

Algorithm

Usage

Command line arguments

Input file format

Input files for usage example

File: rnaaln1.seq

File: rnaaln2.seq

Output file format

Output files for usage example

File: rnaaln1.vrnaaliduplex

Data files

Notes

References

Warnings

Diagnostic Error Messages

Exit status

Known bugs

See also

Author(s)

History

Target users

Comments