|
|
vrnaalifold |
Please help by correcting and extending the Wiki pages.
The original program produces different outputs, depending on the options selected. In the EMBASSY implementation it is split into vrnaalifold and vrnaalifoldpf
% vrnaalifold RNA alignment folding Input (aligned) nucleotide sequence set: ecoli6s.fasta Vienna RNAfold output file [ecoli6s.vrnaalifold]: |
Go to the input files for this example
Go to the output files for this example
Standard (Mandatory) qualifiers:
[-sequence] seqset (Aligned) nucleotide sequence set filename
and optional format, or reference (input
USA)
[-outfile] outfile [*.vrnaalifold] Vienna RNAfold output file
Additional (Optional) qualifiers: (none)
Advanced (Unprompted) qualifiers:
-constraintfile infile Vienna RNA structure constraints file
(optional)
-paramfile infile Vienna RNA parameters file (optional)
-temperature float [37.0] Temperature (Any numeric value)
-[no]gu boolean [Y] Allow GU pairs
-[no]closegu boolean [Y] Allow GU pairs at end of helices
-[no]lp boolean [Y] Allow lonely pairs
-[no]convert boolean [Y] Convert T to U
-nsbases string Non-standard bases (Any string)
-[no]tetraloop boolean [Y] Stabilizing energies for tetra-loops
-circular boolean [N] Circular RNA
-colour boolean [N] Colour structure plot
-energy menu [0] Rarely used option to fold sequences
from the ABCD... alphabet (Values: 0 (BP); 1
(Any with GC); 2 (Any with AU parameters))
-scale float [1.07] Estimate of ensemble free energy (Any
numeric value)
-dangles menu [2] Method (Values: 0 (Ignore); 1 (Only
unpaired bases for just one dangling end); 2
(Always use dangling energies); 3 (Allow
coaxial stacking of adjacent helices))
-covariance float [1.0] Weight for covariance (Any numeric
value)
-nspenalty float [1.0] Non-compatible sequence penalty (Any
numeric value)
-endgaps boolean [N] Mark end gaps
-most boolean [N] Use most informative sequence algorithm
-ssoutfile outfile [*.vrnaalifold] Vienna RNA structure
postscript output file
-alignoutfile outfile [*.vrnaalifold] Vienna RNA alignment
postscript output file
Associated qualifiers:
"-sequence" associated qualifiers
-sbegin1 integer Start of each sequence to be used
-send1 integer End of each sequence to be used
-sreverse1 boolean Reverse (if DNA)
-sask1 boolean Ask for begin/end/reverse
-snucleotide1 boolean Sequence is nucleotide
-sprotein1 boolean Sequence is protein
-slower1 boolean Make lower case
-supper1 boolean Make upper case
-sformat1 string Input sequence format
-sdbname1 string Database name
-sid1 string Entryname
-ufo1 string UFO features
-fformat1 string Features format
-fopenfile1 string Features file name
"-outfile" associated qualifiers
-odirectory2 string Output directory
"-ssoutfile" associated qualifiers
-odirectory string Output directory
"-alignoutfile" associated qualifiers
-odirectory string Output directory
General qualifiers:
-auto boolean Turn off prompts
-stdout boolean Write first file to standard output
-filter boolean Read first file from standard input, write
first file to standard output
-options boolean Prompt for standard and additional values
-debug boolean Write debug output to program.dbg
-verbose boolean Report some/full command line options
-help boolean Report command line options. More
information on associated and general
qualifiers can be found with -help -verbose
-warning boolean Report warnings
-error boolean Report errors
-fatal boolean Report fatal errors
-die boolean Report dying program messages
|
| Qualifier | Type | Description | Allowed values | Default | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Standard (Mandatory) qualifiers | ||||||||||||
| [-sequence] (Parameter 1) |
seqset | (Aligned) nucleotide sequence set filename and optional format, or reference (input USA) | Readable set of sequences | Required | ||||||||
| [-outfile] (Parameter 2) |
outfile | Vienna RNAfold output file | Output file | <*>.vrnaalifold | ||||||||
| Additional (Optional) qualifiers | ||||||||||||
| (none) | ||||||||||||
| Advanced (Unprompted) qualifiers | ||||||||||||
| -constraintfile | infile | Vienna RNA structure constraints file (optional) | Input file | Required | ||||||||
| -paramfile | infile | Vienna RNA parameters file (optional) | Input file | Required | ||||||||
| -temperature | float | Temperature | Any numeric value | 37.0 | ||||||||
| -[no]gu | boolean | Allow GU pairs | Boolean value Yes/No | Yes | ||||||||
| -[no]closegu | boolean | Allow GU pairs at end of helices | Boolean value Yes/No | Yes | ||||||||
| -[no]lp | boolean | Allow lonely pairs | Boolean value Yes/No | Yes | ||||||||
| -[no]convert | boolean | Convert T to U | Boolean value Yes/No | Yes | ||||||||
| -nsbases | string | Non-standard bases | Any string | |||||||||
| -[no]tetraloop | boolean | Stabilizing energies for tetra-loops | Boolean value Yes/No | Yes | ||||||||
| -circular | boolean | Circular RNA | Boolean value Yes/No | No | ||||||||
| -colour | boolean | Colour structure plot | Boolean value Yes/No | No | ||||||||
| -energy | list | Rarely used option to fold sequences from the ABCD... alphabet |
|
0 | ||||||||
| -scale | float | Estimate of ensemble free energy | Any numeric value | 1.07 | ||||||||
| -dangles | list | Method |
|
2 | ||||||||
| -covariance | float | Weight for covariance | Any numeric value | 1.0 | ||||||||
| -nspenalty | float | Non-compatible sequence penalty | Any numeric value | 1.0 | ||||||||
| -endgaps | boolean | Mark end gaps | Boolean value Yes/No | No | ||||||||
| -most | boolean | Use most informative sequence algorithm | Boolean value Yes/No | No | ||||||||
| -ssoutfile | outfile | Vienna RNA structure postscript output file | Output file | <*>.vrnaalifold | ||||||||
| -alignoutfile | outfile | Vienna RNA alignment postscript output file | Output file | <*>.vrnaalifold | ||||||||
>X01238.1/1-183 AUUUCUCUGAGAUGUUCGCAAGCGGGC.CAGUCCCCUGAGCCGAUAUUUCAUACCACAAG AAUGUGGCGCUCCGCGGUUGGUGAGCAUGCUCGGUCCGU...............CCGAGA AGCCUUAAAACUGCGACGACACAUUCACCUUGAACCAA.GGGUUCAAGGGUUACAGCCUG CGGCGGCA.UC.UCGGAG.AUUC >AL627277.1/108623-108805 AUUUCUCUGAGAUGUUUGCAAGCGGGC.CAGUCCCCUGAGCCGAUAUUUCAUACCACAAG AAUGUGGCGCUCCGCGGUUGGUGAGCAUGCUCGGUUCGU...............CCGAGA AGCCUUAAAACUGUGACGACACAUUCACCUUGAACCAA.GGGUUCAAGGGUUACAGCCUG CGGCGGCA.UC.UCGGAG.AUUC >AJ414145.1/90993-91174 AUUUCUCUGAGGUGUUUGCCAGCGGGC.CAGUCCCCUGAGCCGAUAUUUAAUACCAACAG AAUGUAGUGCUCCGUAACCGGUGAGCAUGCUCGGUCCG................CCGAGA AGCCUUAAGGUUGCGACGCUGCGUUCACCUUGAACCAA.GGGUUCAAGGGUUACAGCCUG CGACGGCA.CC.UCGGAG.AUCC >U32767.1/6538-6734 .AUUACCUGGAGUGUUCGUCAGUAGGC.UAUGUCCCUGAGCCGAUACUUUAAAUCUUAUA AAUU.GGUUUCCUAUCGUUGGUGUGUAGGCUUAACCUUUGACUCGUUCAUUGGGCUAAGA AACCUGAAAACGGUAUCAACUGAUUU.CCUUGAACCGUCGGGUUCAAGGACUACUGCCCG CAGCGGCACUC.UGGGGU.CUUC >AE006208.1/8365-8185 .AUUACCUGAGGUGUUUGCCAGUGGGU.UAUGUCCCUGAGCCGAUACUUU.UAUUUUAUG AAUC.GGUUUCUAAUUGUUGGUGUGCAUGCUUAGCUUGA...............CUAAGA AGCCUAAAAAUAGUUAUAACUGAUUC.CCUUGAACCGUUGGGUUCAAGGACUGAGACUUG CAGCGGCA.UC.UCGGGUUCUUC >Y00334.1/77-254 CGCUCCCUGGUGUGUUGGCCAGUCGGU.GAUGUCCCUGAGCCGAUAACUGCAACAAC..G GAGGUUGC.CAGUUGGACCGGUGUGCAUGUCCGCACG.................ACGGAA AGCCUUAAGGUCUAC.UGCAACCGCCACCUUGAACUUUCGGGUUCAAGGGCUA.ACCCGA CAGCGGCA.CGACCGGGG.AGCU >AE004317.1/5626-5807 UUUACCCUGGGGUGUUCGUCAGCGGAUUUAUGUCCCUGAGCCGAUAAGCAACAUAAC..A GGGUUGGUAUUGGGUAGCUAUUGAGCAAGCUCGGCUUGUA..............CCGAGA AGCCUGCGGUUACCAUUACUGAUCCG.CCUUGAACCUGAUGGUUCAAGGGCUACGAUCCU CAACGGCA.UC.CCGGGG.UUC. |
AUUUCCCUGAGGUGUUCGCCAGCGGGC_CAUGUCCCUGAGCCGAUAUUUAAUACCACAAGAAUGUGGUGCUCCGUGGUUGGUGAGCAUGCUCGGCCCGU_______________CCGAGAAGCCUUAAAAUUGCGACGACACAUUCACCUUGAACCAA_GGGUUCAAGGGCUACAGCCUGCAGCGGCA_UC_UCGGGG_AUUC ....(((((((((((.(((..((((((................................(((((((......(((((((...(.((...(((((....................)))))..)))....)))))))....))))))).(((((((((....)))))))))......)))))).)))))).)).))))))..... (-56.91 = -48.71 + -8.20) |
| Program name | Description |
|---|---|
| einverted | Finds inverted repeats in nucleotide sequences |
| vrnaalifoldpf | RNA alignment folding with partition |
| vrnacofold | RNA cofolding |
| vrnacofoldconc | RNA cofolding with concentrations |
| vrnacofoldpf | RNA cofolding with partitioning |
| vrnadistance | RNA distances |
| vrnaduplex | RNA duplex calculation |
| vrnaeval | RNA eval |
| vrnaevalpair | RNA eval with cofold |
| vrnafold | Calculate secondary structures of RNAs |
| vrnafoldpf | Secondary structures of RNAs with partition |
| vrnaheat | RNA melting |
| vrnainverse | RNA sequences matching a structure |
| vrnalfold | Calculate locally stable secondary structures of RNAs |
| vrnaplot | Plot vrnafold output |
| vrnasubopt | Calculate RNA suboptimals |
Although we take every care to ensure that the results of the EMBOSS version are identical to those from the original package, we recommend that you check your inputs give the same results in both versions before publication.
Please report all bugs in the EMBOSS version to the EMBOSS bug team, not to the original author.