vrnafoldpf

 

Wiki

The master copies of EMBOSS documentation are available at http://emboss.open-bio.org/wiki/Appdocs on the EMBOSS Wiki.

Please help by correcting and extending the Wiki pages.

Function

Secondary structures of RNAs with partition

Description

This is a port of the Vienna RNA package program RNAfold.

The original program has additional inputs and produces different outputs, depending on the options selected. In the EMBASSY implementation it is split into vrnafold for a single sequence and vrnafoldpair for a pair of sequences See the original documentation for the Vienna RNA package http://www.tbi.univie.ac.at/~ivo/RNA/

Algorithm

Usage

Here is a sample session with vrnafoldpf


% vrnafoldpf -temperature 42 
Secondary structures of RNAs with partition
Input nucleotide sequence: rna2.seq
Vienna RNAfold output file [rna2.vrnafoldpf]: 

Go to the input files for this example
Go to the output files for this example

Command line arguments

   Standard (Mandatory) qualifiers:
  [-sequence]          sequence   Nucleotide sequence filename and optional
                                  format, or reference (input USA)
  [-outfile]           outfile    [*.vrnafoldpf] Vienna RNAfold output file

   Additional (Optional) qualifiers: (none)
   Advanced (Unprompted) qualifiers:
   -constraintfile     infile     Vienna RNA structure constraints file
                                  (optional)
   -paramfile          infile     Vienna RNA parameters file (optional)
   -temperature        float      [37.0] Temperature (Any numeric value)
   -circular           boolean    [N] Allow circular RNA
   -[no]gu             boolean    [Y] Allow GU pairs
   -[no]closegu        boolean    [Y] Allow GU pairs at end of helices
   -[no]lp             boolean    [Y] Allow lonely pairs
   -[no]convert        boolean    [Y] Convert T to U
   -nsbases            string     Non-standard bases (Any string)
   -[no]tetraloop      boolean    [Y] Stabilizing energies for tetra-loops
   -energy             menu       [0] Rarely used option to fold sequences
                                  from the ABCD... alphabet (Values: 0 (BP); 1
                                  (Any with GC); 2 (Any with AU parameters))
   -scale              float      [1.07] Estimate of ensemble free energy (Any
                                  numeric value)
   -dangles            menu       [1] Method (Values: 0 (Ignore); 1 (Only
                                  unpaired bases for just one dangling end); 2
                                  (Always use dangling energies); 3 (Allow
                                  coaxial stacking of adjacent helices))
   -adotoutfile        outfile    [*.vrnafoldpf] Vienna dotplot postscript
                                  output file
   -bdotoutfile        outfile    [*.vrnafoldpf] Second vienna dotplot
                                  postscript output file
   -ssoutfile          outfile    [*.vrnafoldpf] Third vienna structure
                                  postscript output file

   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin1            integer    Start of the sequence to be used
   -send1              integer    End of the sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -sformat1           string     Input sequence format
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name

   "-outfile" associated qualifiers
   -odirectory2        string     Output directory

   "-adotoutfile" associated qualifiers
   -odirectory         string     Output directory

   "-bdotoutfile" associated qualifiers
   -odirectory         string     Output directory

   "-ssoutfile" associated qualifiers
   -odirectory         string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write first file to standard output
   -filter             boolean    Read first file from standard input, write
                                  first file to standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages

Qualifier Type Description Allowed values Default
Standard (Mandatory) qualifiers
[-sequence]
(Parameter 1)
sequence Nucleotide sequence filename and optional format, or reference (input USA) Readable sequence Required
[-outfile]
(Parameter 2)
outfile Vienna RNAfold output file Output file <*>.vrnafoldpf
Additional (Optional) qualifiers
(none)
Advanced (Unprompted) qualifiers
-constraintfile infile Vienna RNA structure constraints file (optional) Input file Required
-paramfile infile Vienna RNA parameters file (optional) Input file Required
-temperature float Temperature Any numeric value 37.0
-circular boolean Allow circular RNA Boolean value Yes/No No
-[no]gu boolean Allow GU pairs Boolean value Yes/No Yes
-[no]closegu boolean Allow GU pairs at end of helices Boolean value Yes/No Yes
-[no]lp boolean Allow lonely pairs Boolean value Yes/No Yes
-[no]convert boolean Convert T to U Boolean value Yes/No Yes
-nsbases string Non-standard bases Any string  
-[no]tetraloop boolean Stabilizing energies for tetra-loops Boolean value Yes/No Yes
-energy list Rarely used option to fold sequences from the ABCD... alphabet
0 (BP)
1 (Any with GC)
2 (Any with AU parameters)
0
-scale float Estimate of ensemble free energy Any numeric value 1.07
-dangles list Method
0 (Ignore)
1 (Only unpaired bases for just one dangling end)
2 (Always use dangling energies)
3 (Allow coaxial stacking of adjacent helices)
1
-adotoutfile outfile Vienna dotplot postscript output file Output file <*>.vrnafoldpf
-bdotoutfile outfile Second vienna dotplot postscript output file Output file <*>.vrnafoldpf
-ssoutfile outfile Third vienna structure postscript output file Output file <*>.vrnafoldpf

Input file format

vrnafoldpf reads any normal sequence USAs.

Input files for usage example

File: rna2.seq

>rna2
UUGGAGUACACAACCUGUACACUCUUUC

Output file format

vrnafoldpf outputs a graph to the specified graphics device. outputs a report format file. The default format is ...

Output files for usage example

Graphics File: rna2.ssps

[vrnafoldpf results]

Graphics File: rna2.ps

[vrnafoldpf results]

Graphics File: rna2.ps2

[vrnafoldpf results]

File: rna2.vrnafoldpf

UUGGAGUACACAACCUGUACACUCUUUC
.....(((((.....)))))........ ( -3.47)
..{(,(((((.....)))}}.}},,... [ -4.45]
.....(((((.....)))))........ { -3.47 d=4.61}
 frequency of mfe structure in ensemble 0.209182; ensemble diversity 6.08  

Data files

For details of Vienna RNA file formats, see the original documentation http://www.tbi.univie.ac.at/~ivo/RNA/

Notes

None.

References

None.

Warnings

None.

Diagnostic Error Messages

None.

Exit status

It always exits with status 0.

Known bugs

None.

See also

Program name Description
einverted Finds inverted repeats in nucleotide sequences
vrnaalifold RNA alignment folding
vrnaalifoldpf RNA alignment folding with partition
vrnacofold RNA cofolding
vrnacofoldconc RNA cofolding with concentrations
vrnacofoldpf RNA cofolding with partitioning
vrnadistance RNA distances
vrnaduplex RNA duplex calculation
vrnaeval RNA eval
vrnaevalpair RNA eval with cofold
vrnafold Calculate secondary structures of RNAs
vrnaheat RNA melting
vrnainverse RNA sequences matching a structure
vrnalfold Calculate locally stable secondary structures of RNAs
vrnaplot Plot vrnafold output
vrnasubopt Calculate RNA suboptimals

Author(s)

This program is an EMBOSS conversion of a program written by Ivo Hofacker as part of his VIENNA package.

Although we take every care to ensure that the results of the EMBOSS version are identical to those from the original package, we recommend that you check your inputs give the same results in both versions before publication.

Please report all bugs in the EMBOSS version to the EMBOSS bug team, not to the original author.

History

Converted (October 2005) by Alan Bleasby

Target users

This program is intended to be used by everyone and everything, from naive users to embedded scripts.

Comments