|
|
vrnainverse |
Please help by correcting and extending the Wiki pages.
% vrnainverse -repeats 3 RNA sequences matching a structure Vienna RNA structures file: rna3.fold Vienna RNAfold output file [rna3.vrnainverse]: |
Go to the input files for this example
Go to the output files for this example
Example 2
% vrnainverse -repeats 3 -succeed RNA sequences matching a structure Vienna RNA structures file: rna3.fold Vienna RNAfold output file [rna3.vrnainverse]: |
Go to the output files for this example
Standard (Mandatory) qualifiers:
[-structuresfile] infile Vienna RNA structures file
[-outfile] outfile [*.vrnainverse] Vienna RNAfold output file
Additional (Optional) qualifiers: (none)
Advanced (Unprompted) qualifiers:
-sequence sequence Nucleotide sequence filename and optional
format, or reference (input USA)
-paramfile infile Vienna RNA parameters file (optional)
-temperature float [37.0] Temperature (Any numeric value)
-[no]gu boolean [Y] Allow GU pairs
-[no]closegu boolean [Y] Allow GU pairs at end of helices
-[no]lp boolean [Y] Allow lonely pairs
-[no]convert boolean [Y] Convert T to U
-nsbases string Non-standard bases (Any string)
-[no]tetraloop boolean [Y] Stabilizing energies for tetra-loops
-energy menu [0] Rarely used option to fold sequences
from the ABCD... alphabet (Values: 0 (BP); 1
(Any with GC); 2 (Any with AU parameters))
-dangles menu [1] Method (Values: 0 (Ignore); 1 (Only
unpaired bases for just one dangling end); 2
(Always use dangling energies); 3 (Allow
coaxial stacking of adjacent helices))
-folding menu [m] Method (Values: m (Minimum energy); pv
(Partition function); mp (Both))
-alphabet string [AUGC] Find sequences using only these bases
(Any string)
-final float [0.0] Stopping value (Any numeric value)
-repeats integer [0] Number of times to search for the same
structure (Integer 0 or more)
-succeed boolean [N] The original RNAinverse uses a negative
repeat for this
-showfails boolean [N] Show information for unsuccessful
searches
Associated qualifiers:
"-sequence" associated qualifiers
-sbegin integer Start of the sequence to be used
-send integer End of the sequence to be used
-sreverse boolean Reverse (if DNA)
-sask boolean Ask for begin/end/reverse
-snucleotide boolean Sequence is nucleotide
-sprotein boolean Sequence is protein
-slower boolean Make lower case
-supper boolean Make upper case
-sformat string Input sequence format
-sdbname string Database name
-sid string Entryname
-ufo string UFO features
-fformat string Features format
-fopenfile string Features file name
"-outfile" associated qualifiers
-odirectory2 string Output directory
General qualifiers:
-auto boolean Turn off prompts
-stdout boolean Write first file to standard output
-filter boolean Read first file from standard input, write
first file to standard output
-options boolean Prompt for standard and additional values
-debug boolean Write debug output to program.dbg
-verbose boolean Report some/full command line options
-help boolean Report command line options. More
information on associated and general
qualifiers can be found with -help -verbose
-warning boolean Report warnings
-error boolean Report errors
-fatal boolean Report fatal errors
-die boolean Report dying program messages
|
| Qualifier | Type | Description | Allowed values | Default | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Standard (Mandatory) qualifiers | ||||||||||||
| [-structuresfile] (Parameter 1) |
infile | Vienna RNA structures file | Input file | Required | ||||||||
| [-outfile] (Parameter 2) |
outfile | Vienna RNAfold output file | Output file | <*>.vrnainverse | ||||||||
| Additional (Optional) qualifiers | ||||||||||||
| (none) | ||||||||||||
| Advanced (Unprompted) qualifiers | ||||||||||||
| -sequence | sequence | Nucleotide sequence filename and optional format, or reference (input USA) | Readable sequence | Required | ||||||||
| -paramfile | infile | Vienna RNA parameters file (optional) | Input file | Required | ||||||||
| -temperature | float | Temperature | Any numeric value | 37.0 | ||||||||
| -[no]gu | boolean | Allow GU pairs | Boolean value Yes/No | Yes | ||||||||
| -[no]closegu | boolean | Allow GU pairs at end of helices | Boolean value Yes/No | Yes | ||||||||
| -[no]lp | boolean | Allow lonely pairs | Boolean value Yes/No | Yes | ||||||||
| -[no]convert | boolean | Convert T to U | Boolean value Yes/No | Yes | ||||||||
| -nsbases | string | Non-standard bases | Any string | |||||||||
| -[no]tetraloop | boolean | Stabilizing energies for tetra-loops | Boolean value Yes/No | Yes | ||||||||
| -energy | list | Rarely used option to fold sequences from the ABCD... alphabet |
|
0 | ||||||||
| -dangles | list | Method |
|
1 | ||||||||
| -folding | list | Method |
|
m | ||||||||
| -alphabet | string | Find sequences using only these bases | Any string | AUGC | ||||||||
| -final | float | Stopping value | Any numeric value | 0.0 | ||||||||
| -repeats | integer | Number of times to search for the same structure | Integer 0 or more | 0 | ||||||||
| -succeed | boolean | The original RNAinverse uses a negative repeat for this | Boolean value Yes/No | No | ||||||||
| -showfails | boolean | Show information for unsuccessful searches | Boolean value Yes/No | No | ||||||||
(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))).... |
UGUUUUAUUGGUCUCGUCGCUGACCUGGGUGUAUCGAUCAUCUUGUACGGGCUCCAAGCGGGUUCUAGGACACACU 28 d = 1.000000 UCCUUUAUCGCAGAUACAGCCCUGCCCAUGUUAGCCACACAUGCGAUUCACCAUUCCGACUGGUGUAGAGGGUGCG 27 GUUAUUUAUGCGGCAGGACCACCGCGGAGUAGUUCUUAUAUUCACACACUGGUAUUUGCGACCGGGAGUAGCGGCC 19 |
UAUGUGUGUCUGCUUUAACCCGCAGCAACCGGGAUCGACGGUUAUAUGUUUGAUUAACGUUCAAAGCACAUGGUGA 25 GUUGUGAAAGCACAACCUAACGUGCCCUGUGAUCGAUACAUAGUAGUAUGCAAACCACCCUUGUAUCGCGACCUGC 31 GUGAAUUGAGGCGACGAGGUAUGCUAGGGGCCCAACAAGCCCCAACUCCCGCGGCCCUUACGUGGAGUUCAUAUUA 21 |
| Program name | Description |
|---|---|
| einverted | Finds inverted repeats in nucleotide sequences |
| vrnaalifold | RNA alignment folding |
| vrnaalifoldpf | RNA alignment folding with partition |
| vrnacofold | RNA cofolding |
| vrnacofoldconc | RNA cofolding with concentrations |
| vrnacofoldpf | RNA cofolding with partitioning |
| vrnadistance | RNA distances |
| vrnaduplex | RNA duplex calculation |
| vrnaeval | RNA eval |
| vrnaevalpair | RNA eval with cofold |
| vrnafold | Calculate secondary structures of RNAs |
| vrnafoldpf | Secondary structures of RNAs with partition |
| vrnaheat | RNA melting |
| vrnalfold | Calculate locally stable secondary structures of RNAs |
| vrnaplot | Plot vrnafold output |
| vrnasubopt | Calculate RNA suboptimals |
Although we take every care to ensure that the results of the EMBOSS version are identical to those from the original package, we recommend that you check your inputs give the same results in both versions before publication.
Please report all bugs in the EMBOSS version to the EMBOSS bug team, not to the original author.