|
|
vrnaplot |
Please help by correcting and extending the Wiki pages.
% vrnaplot Plot vrnafold output Vienna RNAfold output file: ../vrnafold-keep/rna1.vrnafold Vienna RNAfold output file [rna1.vrnaplot]: |
Go to the input files for this example
Go to the output files for this example
Standard (Mandatory) qualifiers:
[-structuresfile] infile Vienna RNAfold output file
[-outfile] outfile [*.vrnaplot] Vienna RNAfold output file
Additional (Optional) qualifiers: (none)
Advanced (Unprompted) qualifiers:
-layout menu [naview] Layout (Values: radial (Simple
radial); naview (naview))
-optype menu [ps] Type (Values: ps (postscript); gml
(graph meta language); svg (scaleable vector
graphics); xrna (XRNA save file))
-pre string Pre-annotation (Any string)
-post string Post-annotation (Any string)
Associated qualifiers:
"-outfile" associated qualifiers
-odirectory2 string Output directory
General qualifiers:
-auto boolean Turn off prompts
-stdout boolean Write first file to standard output
-filter boolean Read first file from standard input, write
first file to standard output
-options boolean Prompt for standard and additional values
-debug boolean Write debug output to program.dbg
-verbose boolean Report some/full command line options
-help boolean Report command line options. More
information on associated and general
qualifiers can be found with -help -verbose
-warning boolean Report warnings
-error boolean Report errors
-fatal boolean Report fatal errors
-die boolean Report dying program messages
|
| Qualifier | Type | Description | Allowed values | Default | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Standard (Mandatory) qualifiers | ||||||||||||
| [-structuresfile] (Parameter 1) |
infile | Vienna RNAfold output file | Input file | Required | ||||||||
| [-outfile] (Parameter 2) |
outfile | Vienna RNAfold output file | Output file | <*>.vrnaplot | ||||||||
| Additional (Optional) qualifiers | ||||||||||||
| (none) | ||||||||||||
| Advanced (Unprompted) qualifiers | ||||||||||||
| -layout | list | Layout |
|
naview | ||||||||
| -optype | list | Type |
|
ps | ||||||||
| -pre | string | Pre-annotation | Any string | |||||||||
| -post | string | Post-annotation | Any string | |||||||||
CACUACUCCAAGGACCGUAUCUUUCUCAGUGCGACAGUAA .(((..((....)).(((((........)))))..))).. ( -3.50) |
| Program name | Description |
|---|---|
| einverted | Finds inverted repeats in nucleotide sequences |
| vrnaalifold | RNA alignment folding |
| vrnaalifoldpf | RNA alignment folding with partition |
| vrnacofold | RNA cofolding |
| vrnacofoldconc | RNA cofolding with concentrations |
| vrnacofoldpf | RNA cofolding with partitioning |
| vrnadistance | RNA distances |
| vrnaduplex | RNA duplex calculation |
| vrnaeval | RNA eval |
| vrnaevalpair | RNA eval with cofold |
| vrnafold | Calculate secondary structures of RNAs |
| vrnafoldpf | Secondary structures of RNAs with partition |
| vrnaheat | RNA melting |
| vrnainverse | RNA sequences matching a structure |
| vrnalfold | Calculate locally stable secondary structures of RNAs |
| vrnasubopt | Calculate RNA suboptimals |