|
|
vrnasubopt |
Please help by correcting and extending the Wiki pages.
% vrnasubopt Calculate RNA suboptimals Input nucleotide sequence: rna1.seq Vienna RNAfold output file [rna1.vrnasubopt]: |
Go to the input files for this example
Go to the output files for this example
Standard (Mandatory) qualifiers:
[-sequence] sequence Nucleotide sequence filename and optional
format, or reference (input USA)
[-outfile] outfile [*.vrnasubopt] Vienna RNAfold output file
Additional (Optional) qualifiers: (none)
Advanced (Unprompted) qualifiers:
-constraintfile infile Vienna RNA structure constraints file
(optional)
-paramfile infile Vienna RNA parameters file (optional)
-temperature float [37.0] Temperature (Any numeric value)
-circular boolean [N] Allow circular RNA
-dos boolean [N] DOS special corrections
-[no]gu boolean [Y] Allow GU pairs
-[no]closegu boolean [Y] Allow GU pairs at end of helices
-[no]lp boolean [Y] Allow lonely pairs
-[no]convert boolean [Y] Convert T to U
-nsbases string Non-standard bases (Any string)
-[no]tetraloop boolean [Y] Stabilizing energies for tetra-loops
-erange float [1.0] Calculate suboptimal structures within
erange of the mfe (Any numeric value)
-prange float [0.0] Only print structures with energy
within prange of the mfe (Any numeric value)
-sort boolean [N] Sort structures by energy
-logml boolean [N] Logarithmic energy function for
multi-loops
-dangles menu [2] Method (Values: 0 (Ignore); 1 (Only
unpaired bases for just one dangling end); 2
(Always use dangling energies); 3 (Allow
coaxial stacking of adjacent helices))
-nrandom integer [0] Number of random suboptimal structures
(Any integer value)
Associated qualifiers:
"-sequence" associated qualifiers
-sbegin1 integer Start of the sequence to be used
-send1 integer End of the sequence to be used
-sreverse1 boolean Reverse (if DNA)
-sask1 boolean Ask for begin/end/reverse
-snucleotide1 boolean Sequence is nucleotide
-sprotein1 boolean Sequence is protein
-slower1 boolean Make lower case
-supper1 boolean Make upper case
-sformat1 string Input sequence format
-sdbname1 string Database name
-sid1 string Entryname
-ufo1 string UFO features
-fformat1 string Features format
-fopenfile1 string Features file name
"-outfile" associated qualifiers
-odirectory2 string Output directory
General qualifiers:
-auto boolean Turn off prompts
-stdout boolean Write first file to standard output
-filter boolean Read first file from standard input, write
first file to standard output
-options boolean Prompt for standard and additional values
-debug boolean Write debug output to program.dbg
-verbose boolean Report some/full command line options
-help boolean Report command line options. More
information on associated and general
qualifiers can be found with -help -verbose
-warning boolean Report warnings
-error boolean Report errors
-fatal boolean Report fatal errors
-die boolean Report dying program messages
|
| Qualifier | Type | Description | Allowed values | Default | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Standard (Mandatory) qualifiers | ||||||||||||
| [-sequence] (Parameter 1) |
sequence | Nucleotide sequence filename and optional format, or reference (input USA) | Readable sequence | Required | ||||||||
| [-outfile] (Parameter 2) |
outfile | Vienna RNAfold output file | Output file | <*>.vrnasubopt | ||||||||
| Additional (Optional) qualifiers | ||||||||||||
| (none) | ||||||||||||
| Advanced (Unprompted) qualifiers | ||||||||||||
| -constraintfile | infile | Vienna RNA structure constraints file (optional) | Input file | Required | ||||||||
| -paramfile | infile | Vienna RNA parameters file (optional) | Input file | Required | ||||||||
| -temperature | float | Temperature | Any numeric value | 37.0 | ||||||||
| -circular | boolean | Allow circular RNA | Boolean value Yes/No | No | ||||||||
| -dos | boolean | DOS special corrections | Boolean value Yes/No | No | ||||||||
| -[no]gu | boolean | Allow GU pairs | Boolean value Yes/No | Yes | ||||||||
| -[no]closegu | boolean | Allow GU pairs at end of helices | Boolean value Yes/No | Yes | ||||||||
| -[no]lp | boolean | Allow lonely pairs | Boolean value Yes/No | Yes | ||||||||
| -[no]convert | boolean | Convert T to U | Boolean value Yes/No | Yes | ||||||||
| -nsbases | string | Non-standard bases | Any string | |||||||||
| -[no]tetraloop | boolean | Stabilizing energies for tetra-loops | Boolean value Yes/No | Yes | ||||||||
| -erange | float | Calculate suboptimal structures within erange of the mfe | Any numeric value | 1.0 | ||||||||
| -prange | float | Only print structures with energy within prange of the mfe | Any numeric value | 0.0 | ||||||||
| -sort | boolean | Sort structures by energy | Boolean value Yes/No | No | ||||||||
| -logml | boolean | Logarithmic energy function for multi-loops | Boolean value Yes/No | No | ||||||||
| -dangles | list | Method |
|
2 | ||||||||
| -nrandom | integer | Number of random suboptimal structures | Any integer value | 0 | ||||||||
>rna1 CACUACUCCAAGGACCGUAUCUUUCUCAGUGCGACAGUAA |
> rna1 [100] CACUACUCCAAGGACCGUAUCUUUCUCAGUGCGACAGUAA -380 100 ...(((((....)).((((.((.....))))))...))). -2.80 ...(((((....)).(((((........)))))...))). -3.80 ...(((((....)..(((((........)))))..)))). -3.10 .(((..((....)).((((.((.....))))))..))).. -2.80 .(((..((....)).(((((........)))))..))).. -3.80 ......((....)).(((((........)))))....... -3.10 ...............(((((........)))))....... -3.30 |
| Program name | Description |
|---|---|
| einverted | Finds inverted repeats in nucleotide sequences |
| vrnaalifold | RNA alignment folding |
| vrnaalifoldpf | RNA alignment folding with partition |
| vrnacofold | RNA cofolding |
| vrnacofoldconc | RNA cofolding with concentrations |
| vrnacofoldpf | RNA cofolding with partitioning |
| vrnadistance | RNA distances |
| vrnaduplex | RNA duplex calculation |
| vrnaeval | RNA eval |
| vrnaevalpair | RNA eval with cofold |
| vrnafold | Calculate secondary structures of RNAs |
| vrnafoldpf | Secondary structures of RNAs with partition |
| vrnaheat | RNA melting |
| vrnainverse | RNA sequences matching a structure |
| vrnalfold | Calculate locally stable secondary structures of RNAs |
| vrnaplot | Plot vrnafold output |
Although we take every care to ensure that the results of the EMBOSS version are identical to those from the original package, we recommend that you check your inputs give the same results in both versions before publication.
Please report all bugs in the EMBOSS version to the EMBOSS bug team, not to the original author.