|
|
abiview |
Please help by correcting and extending the Wiki pages.
abiview reads in an ABI sequencer trace file and graphically displays the data. The probabilities of each of the 4 nucleotide bases along the sequencing run is plotted and the assigned nucleotide (G, A, T, C or N) from the ABI file is overlayed on the graphs. The complete sequence is written to an output file.
% abiview -graph cps Display the trace in an ABI sequencer file ABI sequencing trace file: abiview.abi nucleotide output sequence [abiview.fasta]: Created abiview.ps |
Go to the input files for this example
Go to the output files for this example
Standard (Mandatory) qualifiers: [-infile] infile ABI sequencing trace file [-outseq] seqout [ |
| Qualifier | Type | Description | Allowed values | Default |
|---|---|---|---|---|
| Standard (Mandatory) qualifiers | ||||
| [-infile] (Parameter 1) |
infile | ABI sequencing trace file | Input file | Required |
| [-outseq] (Parameter 2) |
seqout | Nucleotide sequence filename and optional format (output USA) | Writeable sequence | <*>.format |
| -graph | xygraph | Graph type | EMBOSS has a list of known devices, including ps, hpgl, hp7470, hp7580, meta, cps, x11, tekt, tek, none, data, das, xterm, png, gif | EMBOSS_GRAPHICS value, or x11 |
| Additional (Optional) qualifiers | ||||
| -startbase | integer | First base to report or display | Integer 0 or more | 0 |
| -endbase | integer | Last sequence base to report or display. If the default is set to zero then the value of this is taken as the maximum number of bases. | Any integer value | 0 |
| -yticks | boolean | Display y-axis ticks | Boolean value Yes/No | No |
| -[no]sequence | boolean | Display the sequence on the graph | Boolean value Yes/No | Yes |
| -window | integer | Sequence display window size | Any integer value | 40 |
| -bases | string | Base graphs to be displayed | Any string, matching regular expression /[GATC]+/ | GATC |
| Advanced (Unprompted) qualifiers | ||||
| -separate | boolean | Separate the trace graphs for the 4 bases | Boolean value Yes/No | No |
This file contains non-printing characters and so cannot be displayed here.
This file contains non-printing characters and so cannot be displayed here.
>../../data/abiview.abi GNNNNNNNNNGNGNNGGGGTTTNANNNTNNNAGAACCCCCCTTNGAAAANNNCCACCCCA NNATAGTNGTANGAATAGTNCCCAGGCCANGCCTATCTGTGATGATTACATAGGCTAACA CATGACAAACATTTAAAAACACTAAACAATTGTTATTTATTCTTTGTTCCTATAAACCAC ACCCATTAAGCCCTTACTATATATAAGAGTTTTCAAGCCAAGAACCTGCTGCTTGGGAGG CTGATGCAGGAGAATTGCCAAGTACAAACCCTGCCTGGACTGTAAAGTGAAACCAAGGCT AGTTGTCTCACAATAAAAGATGAAGGGCAAGTGGGATCAATGCATAAAGGAGCTTGTGCC CAAGCCTGTTAGCCTTAGTTCAATTCCTGAGTACCATGAAAAGGTAGAAGGAGAGAAATG ATTTGGTACAATTTTTCTCTGTGCTGTGACACAGTACCACCCTCCTACTAATAACAAATA AAATAATGTTTAAAACAAAATAAAATAAAAATGGACTGGGATGTAGCACAATGGTAGGGT ACTTGCATAGCATGTACAAGGACCTGATTTCAATCCCCTGTGATAAAAGAAAATAAGGAA GGGAGGAAGCGTTAGGAGGAAAAATGGAATACAGAAGACACAGTGCATGGGAAGGATATG TATGTTATGAACACCAGAAATTCACTTGAAAATGAGTAAAATTTTTTTATTATTATATCA TTATTATTGGGGGGGATGTGGGCGGGGCTTGCAGAGGTATCTTTTAGAGGANGATCATTT TCCGGTTGTTGAGCAGGGCTCTGTTATGTAGGATATCTCAGANTAACAGACCCCAGGT |
The horizontal scale of the output image labelled 'Residue Position' is only a very approximate indication of the spacing of residues in the image. The real residue spacing is variable, as it relies on the speed with which the oligo-nucleotides are eluted in the ABI sequencer. Do not be surprised to see the nucleotide signals spaced at a much greater distance than the horizontal scale might suggest.
An ABI file (*.abi) contains sequence trace data and base calls from a run of an ABI nucleotide sequencer machine. A trace data file is what you get back from having some DNA sequenced, for example, by a 3730XL sequencer. The files are in "binary" format and so cannot be viewed directly on screen. To inspect the sequencing data you must use a trace viewer such as abiview. Another good trace viewer is FinchTV (http://www.geospiza.com/finchtv/). It is stand-alone program and is freely available.
| Program name | Description |
|---|---|
| cirdna | Draws circular maps of DNA constructs |
| lindna | Draws linear maps of DNA constructs |
| pepnet | Draw a helical net for a protein sequence |
| pepwheel | Draw a helical wheel diagram for a protein sequence |
| prettyplot | Draw a sequence alignment with pretty formatting |
| prettyseq | Write a nucleotide sequence and its translation to file |
| remap | Display restriction enzyme binding sites in a nucleotide sequence |
| seealso | Finds programs with similar function to a specified program |
| showalign | Display a multiple sequence alignment in pretty format |
| showdb | Displays information on configured databases |
| showfeat | Display features of a sequence in pretty format |
| showpep | Displays protein sequences with features in pretty format |
| showseq | Displays sequences with features in pretty format |
| sixpack | Display a DNA sequence with 6-frame translation and ORFs |
| textsearch | Search the textual description of sequence(s) |