degapseq

 

Function

Removes gap characters from sequences

Description

degapseq reads in one or more sequences and writes them out again minus any gap characters. In effect it removes gaps from aligned sequences.

In fact, if does more than just this as it removes ANY non-alphabetic character from the input sequence, so as well as removing the gap-characters, it will remove such things as the '*' in protein sequences that indicates the position of a 'translated' STOP codon.

There are many different formats for storing sequences in files. Some sequence formats allow you to store aligned sequences, including the information on where gaps have been introduced to make the sequence align properly. This is indicated by using a special character to indicate that there is a gap at that position. Different sequence formats use different characters to indicate gaps. Some formats may use more than one type of character to indicate different types of gaps (e.g. gaps at the ends of the sequences, internal gaps, gaps introduced by a program or by a person editing the alignment, etc.) Some typicate characters used to indicate where gaps are may be: '.', '-' and '~'.

When EMBOSS programs read in a sequence that has gap-characters in, all gap characters are internally changed to '-' characters. i.e. EMBOSS only has one type of gap character. Thus any distinguishing characters for different gap types are reduced to a '-'. There is only one type of gap in EMBOSS.

degapseq removes any non-alphabetic character in the sequence, in effect this means that gaps and '*' characters are removed. The sequence is then written out.

Usage

Here is a sample session with degapseq


% degapseq dnagap.fasta nogaps.seq 
Removes gap characters from sequences

Go to the input files for this example
Go to the output files for this example

Command line arguments

   Standard (Mandatory) qualifiers:
  [-sequence]          seqall     (Gapped) sequence(s) filename and optional
                                  format, or reference (input USA)
  [-outseq]            seqoutall  [.] Sequence set(s)
                                  filename and optional format (output USA)

   Additional (Optional) qualifiers: (none)
   Advanced (Unprompted) qualifiers: (none)
   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin1            integer    Start of each sequence to be used
   -send1              integer    End of each sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -sformat1           string     Input sequence format
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name

   "-outseq" associated qualifiers
   -osformat2          string     Output seq format
   -osextension2       string     File name extension
   -osname2            string     Base file name
   -osdirectory2       string     Output directory
   -osdbname2          string     Database name to add
   -ossingle2          boolean    Separate file for each entry
   -oufo2              string     UFO features
   -offormat2          string     Features format
   -ofname2            string     Features file name
   -ofdirectory2       string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write first file to standard output
   -filter             boolean    Read first file from standard input, write
                                  first file to standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages

Standard (Mandatory) qualifiers Allowed values Default
[-sequence]
(Parameter 1)
(Gapped) sequence(s) filename and optional format, or reference (input USA) Readable sequence(s) Required
[-outseq]
(Parameter 2)
Sequence set(s) filename and optional format (output USA) Writeable sequence(s) <*>.format
Additional (Optional) qualifiers Allowed values Default
(none)
Advanced (Unprompted) qualifiers Allowed values Default
(none)

Input file format

Any valid input sequence USA is allowed.

The input sequence can be nucleic or protein.

The input sequence can be gapped or ungapped.

Input files for usage example

File: dnagap.fasta

>FASTA F10002 FASTA FORMAT DNA SEQUENCE
ACGT....ACGTACGTACGTACGTACGTACGTACGTACGT
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
ACGTACGTACGTACGTACGT

Output file format

The output is a sequence with no gaps.

Output files for usage example

File: nogaps.seq

>FASTA F10002 FASTA FORMAT DNA SEQUENCE
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
ACGTACGTACGTACGTACGTACGTACGTACGTACGT

Data files

None.

Notes

None.

References

None.

Warnings

It will remove '*' characters from protein sequences as well as removing the gap characters.

Diagnostic Error Messages

None.

Exit status

It always exits with status 0.

Known bugs

None.

See also

Program nameDescription
biosed Replace or delete sequence sections
codcopy Reads and writes a codon usage table
cutseq Removes a specified section from a sequence
descseq Alter the name or description of a sequence
entret Reads and writes (returns) flatfile entries
extractalign Extract regions from a sequence alignment
extractfeat Extract features from a sequence
extractseq Extract regions from a sequence
listor Write a list file of the logical OR of two sets of sequences
makenucseq Creates random nucleotide sequences
makeprotseq Creates random protein sequences
maskfeat Mask off features of a sequence
maskseq Mask off regions of a sequence
newseq Type in a short new sequence
noreturn Removes carriage return from ASCII files
notseq Exclude a set of sequences and write out the remaining ones
nthseq Writes one sequence from a multiple set of sequences
pasteseq Insert one sequence into another
revseq Reverse and complement a sequence
seqret Reads and writes (returns) sequences
seqretsplit Reads and writes (returns) sequences in individual files
skipseq Reads and writes (returns) sequences, skipping first few
splitter Split a sequence into (overlapping) smaller sequences
trimest Trim poly-A tails off EST sequences
trimseq Trim ambiguous bits off the ends of sequences
union Reads sequence fragments and builds one sequence
vectorstrip Strips out DNA between a pair of vector sequences
yank Reads a sequence range, appends the full USA to a list file

Author(s)

Gary Williams (gwilliam © rfcgr.mrc.ac.uk)
MRC Rosalind Franklin Centre for Genomics Research Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SB, UK

History

Written (6 March 2001) - Gary Williams

Target users

This program is intended to be used by everyone and everything, from naive users to embedded scripts.

Comments

None