|
|
listor |
Please help by correcting and extending the Wiki pages.
listor reads in two sets of sequences (typically specified as list files) and writes out a list file that result from the logical union of the two sets. A list file is a file with a list of Uniform Sequence Addresses (USAs), for example, a list of file names. When comparing sequences from the input sets, no use is made of the ID name or accession number; only the sequence itself is compared. The comparison of the sequences is case-independent. The logical union is an OR operation by default. Other available operations are: AND, XOR and NOT.
All the input sequences are kept in memory while the logical unions of the two input sets of sequences is calculated. listor is therefore restricted by the available memory.
Write the logical OR of two lists:
% listor ../data/file2 Write a list file of the logical OR of two sets of sequences List of USAs output file [file1.list]: |
Go to the input files for this example
Go to the output files for this example
Example 2
Write the logical AND of two lists:
% listor ../data/file2 -operator and Write a list file of the logical OR of two sets of sequences List of USAs output file [file1.list]: |
Go to the output files for this example
Example 3
Write the logical XOR of two lists:
% listor ../data/file2 -operator xor Write a list file of the logical OR of two sets of sequences List of USAs output file [file1.list]: |
Go to the output files for this example
Example 4
Write the logical NOT of two lists:
% listor ../data/file2 -operator not Write a list file of the logical OR of two sets of sequences List of USAs output file [file1.list]: |
Go to the output files for this example
Standard (Mandatory) qualifiers:
[-firstsequences] seqset Sequence set filename and optional format,
or reference (input USA)
[-secondsequences] seqset Sequence set filename and optional format,
or reference (input USA)
[-outfile] outfile [*.listor] The list of sequence names will
be written to this list file
Additional (Optional) qualifiers:
-operator menu [OR] The following logical operators combine
the sequences in the following ways:
OR - gives all that occur in one set or the
other
AND - gives only those which occur in both
sets
XOR - gives those which only occur in one
set or the other, but not in both
NOT - gives those which occur in the first
set except for those that also occur in the
second (Values: O (OR - merger of both
sets); A (AND - only those in both sets); X
(XOR - only those not in both sets); N (NOT
- those of the first set that are not in the
second))
Advanced (Unprompted) qualifiers: (none)
Associated qualifiers:
"-firstsequences" associated qualifiers
-sbegin1 integer Start of each sequence to be used
-send1 integer End of each sequence to be used
-sreverse1 boolean Reverse (if DNA)
-sask1 boolean Ask for begin/end/reverse
-snucleotide1 boolean Sequence is nucleotide
-sprotein1 boolean Sequence is protein
-slower1 boolean Make lower case
-supper1 boolean Make upper case
-sformat1 string Input sequence format
-sdbname1 string Database name
-sid1 string Entryname
-ufo1 string UFO features
-fformat1 string Features format
-fopenfile1 string Features file name
"-secondsequences" associated qualifiers
-sbegin2 integer Start of each sequence to be used
-send2 integer End of each sequence to be used
-sreverse2 boolean Reverse (if DNA)
-sask2 boolean Ask for begin/end/reverse
-snucleotide2 boolean Sequence is nucleotide
-sprotein2 boolean Sequence is protein
-slower2 boolean Make lower case
-supper2 boolean Make upper case
-sformat2 string Input sequence format
-sdbname2 string Database name
-sid2 string Entryname
-ufo2 string UFO features
-fformat2 string Features format
-fopenfile2 string Features file name
"-outfile" associated qualifiers
-odirectory3 string Output directory
General qualifiers:
-auto boolean Turn off prompts
-stdout boolean Write first file to standard output
-filter boolean Read first file from standard input, write
first file to standard output
-options boolean Prompt for standard and additional values
-debug boolean Write debug output to program.dbg
-verbose boolean Report some/full command line options
-help boolean Report command line options. More
information on associated and general
qualifiers can be found with -help -verbose
-warning boolean Report warnings
-error boolean Report errors
-fatal boolean Report fatal errors
-die boolean Report dying program messages
|
| Qualifier | Type | Description | Allowed values | Default | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Standard (Mandatory) qualifiers | ||||||||||||
| [-firstsequences] (Parameter 1) |
seqset | Sequence set filename and optional format, or reference (input USA) | Readable set of sequences | Required | ||||||||
| [-secondsequences] (Parameter 2) |
seqset | Sequence set filename and optional format, or reference (input USA) | Readable set of sequences | Required | ||||||||
| [-outfile] (Parameter 3) |
outfile | The list of sequence names will be written to this list file | Output file | <*>.listor | ||||||||
| Additional (Optional) qualifiers | ||||||||||||
| -operator | list | The following logical operators combine the sequences in the following ways: OR - gives all that occur in one set or the other AND - gives only those which occur in both sets XOR - gives those which only occur in one set or the other, but not in both NOT - gives those which occur in the first set except for those that also occur in the second |
|
OR | ||||||||
| Advanced (Unprompted) qualifiers | ||||||||||||
| (none) | ||||||||||||
>one tagctagcg >two tagctagcggctacgt >three tagctattttatgctacgtcagtgac |
>two tagctagcggctacgt >three tagctattttatgctacgtcagtgac >four gcgcggcgcgcgtgcgtcgttgctggggccc |
The order that the USAs are written out is not necessarily the same as the order of either of the input sets of sequences.
The results of the four types of logical union follows. Note that the duplicated sequences in these two files have been given the same name. This is not necessary for the operation of listor as it compares the sequences themselves, not the ID names of the sequences.
fasta::../../data/file1:one fasta::../../data/file1:two fasta::../../data/file1:three fasta::../../data/file2:four |
fasta::../../data/file1:two fasta::../../data/file1:three |
fasta::../../data/file1:one fasta::../../data/file2:four |
fasta::../../data/file1:one |
The inputs can be any valid USA but typically reference a list file. Some other reference such as a wildcarded database entries or file name are equally valid.
The (default) logical OR of the two sets of sequences is simply the result of merging the two sets of sequences. A sequences appearing in both input sets is referenced once only in the output file. A logical AND simply lists those sequences that occur in both sets of sequences.
A logical XOR lists those sequences that ONLY occur in the first set or only occur in the second set - sequences occuring in both sets are omitted (the opposite of an AND).
A logical NOT lists all those sequences in the first set except for those that also occur in the second set.
listor is restricted by the available memory. Doing logical unions involving all of the sequences in large databases, such as EMBL, is probably impractical unless you are lucky enough to have extraordinary amounts of memory on your machine.
| Program name | Description |
|---|---|
| aligncopy | Reads and writes alignments |
| aligncopypair | Reads and writes pairs from alignments |
| biosed | Replace or delete sequence sections |
| codcopy | Copy and reformat a codon usage table |
| cutseq | Removes a section from a sequence |
| degapseq | Removes non-alphabetic (e.g. gap) characters from sequences |
| descseq | Alter the name or description of a sequence |
| entret | Retrieves sequence entries from flatfile databases and files |
| extractalign | Extract regions from a sequence alignment |
| extractfeat | Extract features from sequence(s) |
| extractseq | Extract regions from a sequence |
| featcopy | Reads and writes a feature table |
| featreport | Reads and writes a feature table |
| makenucseq | Create random nucleotide sequences |
| makeprotseq | Create random protein sequences |
| maskambignuc | Masks all ambiguity characters in nucleotide sequences with N |
| maskambigprot | Masks all ambiguity characters in protein sequences with X |
| maskfeat | Write a sequence with masked features |
| maskseq | Write a sequence with masked regions |
| newseq | Create a sequence file from a typed-in sequence |
| nohtml | Remove mark-up (e.g. HTML tags) from an ASCII text file |
| noreturn | Remove carriage return from ASCII files |
| nospace | Remove all whitespace from an ASCII text file |
| notab | Replace tabs with spaces in an ASCII text file |
| notseq | Write to file a subset of an input stream of sequences |
| nthseq | Write to file a single sequence from an input stream of sequences |
| nthseqset | Reads and writes (returns) one set of sequences from many |
| pasteseq | Insert one sequence into another |
| revseq | Reverse and complement a nucleotide sequence |
| seqret | Reads and writes (returns) sequences |
| seqretsetall | Reads and writes (returns) many sets of sequences |
| seqretsplit | Reads sequences and writes them to individual files |
| sizeseq | Sort sequences by size |
| skipredundant | Remove redundant sequences from an input set |
| skipseq | Reads and writes (returns) sequences, skipping first few |
| splitsource | Split sequence(s) into original source sequences |
| splitter | Split sequence(s) into smaller sequences |
| trimest | Remove poly-A tails from nucleotide sequences |
| trimseq | Remove unwanted characters from start and end of sequence(s) |
| trimspace | Remove extra whitespace from an ASCII text file |
| union | Concatenate multiple sequences into a single sequence |
| vectorstrip | Removes vectors from the ends of nucleotide sequence(s) |
| yank | Add a sequence reference (a full USA) to a list file |