|
|
msbar |
Please help by correcting and extending the Wiki pages.
This program changes a sequence, attempting to emulate various forms of mutation. It reads one or more sequences and writes an output file with with a set of (mutated) sequences. The number, size and type of mutation may be specified.
This asks for 5 mutations, with point mutations as changes (substitutions), and the codon and block mutations ignored.
% msbar
Mutate a sequence
Input sequence(s): tembl:j01636
Number of times to perform the mutation operations [1]: 5
Point mutation operations
0 : None
1 : Any of the following
2 : Insertions
3 : Deletions
4 : Changes
5 : Duplications
6 : Moves
Types of point mutations to perform [0]: 4
Block mutation operations
0 : None
1 : Any of the following
2 : Insertions
3 : Deletions
4 : Changes
5 : Duplications
6 : Moves
Types of block mutations to perform [0]:
Codon mutation operations
0 : None
1 : Any of the following
2 : Insertions
3 : Deletions
4 : Changes
5 : Duplications
6 : Moves
Types of codon mutations to perform [0]:
output sequence(s) [j01636.fasta]:
|
Go to the input files for this example
Go to the output files for this example
Standard (Mandatory) qualifiers (* if not always prompted):
[-sequence] seqall Sequence(s) filename and optional format, or
reference (input USA)
-count integer [1] Number of times to perform the mutation
operations (Integer 0 or more)
-point menu [0] Types of point mutations to perform
(Values: 0 (None); 1 (Any of the following);
2 (Insertions); 3 (Deletions); 4 (Changes);
5 (Duplications); 6 (Moves))
-block menu [0] Types of block mutations to perform
(Values: 0 (None); 1 (Any of the following);
2 (Insertions); 3 (Deletions); 4 (Changes);
5 (Duplications); 6 (Moves))
* -codon menu [0] Types of codon mutations to perform.
These are only done if the sequence is
nucleic. (Values: 0 (None); 1 (Any of the
following); 2 (Insertions); 3 (Deletions); 4
(Changes); 5 (Duplications); 6 (Moves))
[-outseq] seqoutall [
|
| Qualifier | Type | Description | Allowed values | Default | ||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Standard (Mandatory) qualifiers | ||||||||||||||||||
| [-sequence] (Parameter 1) |
seqall | Sequence(s) filename and optional format, or reference (input USA) | Readable sequence(s) | Required | ||||||||||||||
| -count | integer | Number of times to perform the mutation operations | Integer 0 or more | 1 | ||||||||||||||
| -point | list | Types of point mutations to perform |
|
0 | ||||||||||||||
| -block | list | Types of block mutations to perform |
|
0 | ||||||||||||||
| -codon | list | Types of codon mutations to perform. These are only done if the sequence is nucleic. |
|
0 | ||||||||||||||
| [-outseq] (Parameter 2) |
seqoutall | Sequence set(s) filename and optional format (output USA) | Writeable sequence(s) | <*>.format | ||||||||||||||
| Additional (Optional) qualifiers | ||||||||||||||||||
| -inframe | boolean | Do 'codon' and 'block' operations in frame | Boolean value Yes/No | No | ||||||||||||||
| Advanced (Unprompted) qualifiers | ||||||||||||||||||
| -othersequence | seqall | If you require that the resulting mutated sequence should not match a set of other sequences, then you can specify that set of sequences here. For example, if you require that the mutated sequence should not be the same as the input sequence, enter the input sequence here. If you want the result to be different to previous results of this program, specify the previous result sequences here. The program will check that the result does not match the sequences specified here before writing it out. If a match is found, then the mutation is started again with a fresh copy of the input sequence. If, after 10 such retries, there is still a match to the set of sequence given here, then the matching mutated sequence is written with a warning message. | Readable sequence(s) | asis:N | ||||||||||||||
| -minimum | integer | Minimum size for a block mutation | Integer 0 or more | 1 | ||||||||||||||
| -maximum | integer | Maximum size for a block mutation | Any integer value | 10 | ||||||||||||||
ID J01636; SV 1; linear; genomic DNA; STD; PRO; 7477 BP.
XX
AC J01636; J01637; K01483; K01793;
XX
DT 30-NOV-1990 (Rel. 26, Created)
DT 09-SEP-2004 (Rel. 81, Last updated, Version 8)
XX
DE E.coli lactose operon with lacI, lacZ, lacY and lacA genes.
XX
KW acetyltransferase; beta-D-galactosidase; galactosidase; lac operon;
KW lac repressor protein; lacA gene; lacI gene; lactose permease; lacY gene;
KW lacZ gene; mutagenesis; palindrome; promoter region;
KW thiogalactoside acetyltransferase.
XX
OS Escherichia coli
OC Bacteria; Proteobacteria; Gammaproteobacteria; Enterobacteriales;
OC Enterobacteriaceae; Escherichia.
XX
RN [1]
RP 1243-1266
RX DOI; 10.1073/pnas.70.12.3581.
RX PUBMED; 4587255.
RA Gilbert W., Maxam A.;
RT "The nucleotide sequence of the lac operator";
RL Proc. Natl. Acad. Sci. U.S.A. 70(12):3581-3584(1973).
XX
RN [2]
RP 1246-1308
RX DOI; 10.1073/pnas.70.12.3585.
RX PUBMED; 4587256.
RA Maizels N.M.;
RT "The nucleotide sequence of the lactose messenger ribonucleic acid
RT transcribed from the UV5 promoter mutant of Escherichia coli";
RL Proc. Natl. Acad. Sci. U.S.A. 70(12):3585-3589(1973).
XX
RN [3]
RX PUBMED; 4598642.
RA Gilbert W., Maizels N., Maxam A.;
RT "Sequences of controlling regions of the lactose operon";
RL Cold Spring Harb. Symp. Quant. Biol. 38:845-855(1974).
XX
RN [4]
RA Gilbert W., Gralla J., Majors A.J., Maxam A.;
RT "Lactose operator sequences and the action of lac repressor";
RL (in) Sund H., Blauer G. (Eds.);
RL PROTEIN-LIGAND INTERACTIONS:193-207;
RL Walter de Gruyter, New York (1975)
XX
RN [5]
RP 1146-1282
[Part of this file has been deleted for brevity]
cgatttggct acatgacatc aaccatatca gcaaaagtga tacgggtatt atttttgccg 4560
ctatttctct gttctcgcta ttattccaac cgctgtttgg tctgctttct gacaaactcg 4620
ggctgcgcaa atacctgctg tggattatta ccggcatgtt agtgatgttt gcgccgttct 4680
ttatttttat cttcgggcca ctgttacaat acaacatttt agtaggatcg attgttggtg 4740
gtatttatct aggcttttgt tttaacgccg gtgcgccagc agtagaggca tttattgaga 4800
aagtcagccg tcgcagtaat ttcgaatttg gtcgcgcgcg gatgtttggc tgtgttggct 4860
gggcgctgtg tgcctcgatt gtcggcatca tgttcaccat caataatcag tttgttttct 4920
ggctgggctc tggctgtgca ctcatcctcg ccgttttact ctttttcgcc aaaacggatg 4980
cgccctcttc tgccacggtt gccaatgcgg taggtgccaa ccattcggca tttagcctta 5040
agctggcact ggaactgttc agacagccaa aactgtggtt tttgtcactg tatgttattg 5100
gcgtttcctg cacctacgat gtttttgacc aacagtttgc taatttcttt acttcgttct 5160
ttgctaccgg tgaacagggt acgcgggtat ttggctacgt aacgacaatg ggcgaattac 5220
ttaacgcctc gattatgttc tttgcgccac tgatcattaa tcgcatcggt gggaaaaacg 5280
ccctgctgct ggctggcact attatgtctg tacgtattat tggctcatcg ttcgccacct 5340
cagcgctgga agtggttatt ctgaaaacgc tgcatatgtt tgaagtaccg ttcctgctgg 5400
tgggctgctt taaatatatt accagccagt ttgaagtgcg tttttcagcg acgatttatc 5460
tggtctgttt ctgcttcttt aagcaactgg cgatgatttt tatgtctgta ctggcgggca 5520
atatgtatga aagcatcggt ttccagggcg cttatctggt gctgggtctg gtggcgctgg 5580
gcttcacctt aatttccgtg ttcacgctta gcggccccgg cccgctttcc ctgctgcgtc 5640
gtcaggtgaa tgaagtcgct taagcaatca atgtcggatg cggcgcgacg cttatccgac 5700
caacatatca taacggagtg atcgcattga acatgccaat gaccgaaaga ataagagcag 5760
gcaagctatt taccgatatg tgcgaaggct taccggaaaa aagacttcgt gggaaaacgt 5820
taatgtatga gtttaatcac tcgcatccat cagaagttga aaaaagagaa agcctgatta 5880
aagaaatgtt tgccacggta ggggaaaacg cctgggtaga accgcctgtc tatttctctt 5940
acggttccaa catccatata ggccgcaatt tttatgcaaa tttcaattta accattgtcg 6000
atgactacac ggtaacaatc ggtgataacg tactgattgc acccaacgtt actctttccg 6060
ttacgggaca ccctgtacac catgaattga gaaaaaacgg cgagatgtac tcttttccga 6120
taacgattgg caataacgtc tggatcggaa gtcatgtggt tattaatcca ggcgtcacca 6180
tcggggataa ttctgttatt ggcgcgggta gtatcgtcac aaaagacatt ccaccaaacg 6240
tcgtggcggc tggcgttcct tgtcgggtta ttcgcgaaat aaacgaccgg gataagcact 6300
attatttcaa agattataaa gttgaatcgt cagtttaaat tataaaaatt gcctgatacg 6360
ctgcgcttat caggcctaca agttcagcga tctacattag ccgcatccgg catgaacaaa 6420
gcgcaggaac aagcgtcgca tcatgcctct ttgacccaca gctgcggaaa acgtactggt 6480
gcaaaacgca gggttatgat catcagccca acgacgcaca gcgcatgaaa tgcccagtcc 6540
atcaggtaat tgccgctgat actacgcagc acgccagaaa accacggggc aagcccggcg 6600
atgataaaac cgattccctg cataaacgcc accagcttgc cagcaatagc cggttgcaca 6660
gagtgatcga gcgccagcag caaacagagc ggaaacgcgc cgcccagacc taacccacac 6720
accatcgccc acaataccgg caattgcatc ggcagccaga taaagccgca gaaccccacc 6780
agttgtaaca ccagcgccag cattaacagt ttgcgccgat cctgatggcg agccatagca 6840
ggcatcagca aagctcctgc ggcttgccca agcgtcatca atgccagtaa ggaaccgctg 6900
tactgcgcgc tggcaccaat ctcaatatag aaagcgggta accaggcaat caggctggcg 6960
taaccgccgt taatcagacc gaagtaaaca cccagcgtcc acgcgcgggg agtgaatacc 7020
acgcgaaccg gagtggttgt tgtcttgtgg gaagaggcga cctcgcgggc gctttgccac 7080
caccaggcaa agagcgcaac aacggcaggc agcgccacca ggcgagtgtt tgataccagg 7140
tttcgctatg ttgaactaac cagggcgtta tggcggcacc aagcccaccg ccgcccatca 7200
gagccgcgga ccacagcccc atcaccagtg gcgtgcgctg ctgaaaccgc cgtttaatca 7260
ccgaagcatc accgcctgaa tgatgccgat ccccacccca ccaagcagtg cgctgctaag 7320
cagcagcgca ctttgcgggt aaagctcacg catcaatgca ccgacggcaa tcagcaacag 7380
actgatggcg acactgcgac gttcgctgac atgctgatga agccagcttc cggccagcgc 7440
cagcccgccc atggtaacca ccggcagagc ggtcgac 7477
//
|
>J01636 J01636.1 E.coli lactose operon with lacI, lacZ, lacY and lacA genes. gacaccatcgaatggcgcaaaacctttcgcggtatggcatgatagcgcccggaagagagt caattcagggtggtgaatgtgaaaccagtaacgttatacgatgtcgcagagtatgccggt gtctcttatcagaccgtttcccgcgtggtgaaccaggccagccacgtttctgcgaaaacg cgggaaaaagtggaagcggcgatggcggagctgaattacattcccaaccgcgtggcacaa caactggcgggcaaacagtcgttgctgattggcgttgccacctccagtctggccctgcac gcgccgtcgcaaattgtcgcggcgattaaatctcgcgccgatcaactgggtgccagcgtg gtggtgtcgatggtagaacgaagcggcgtcgaagcctgtaaagcggcggtgcacaatctt ctcgcgcaacgcgtcagtgggctgatcattaactatccgctggatgaccaggatgccatt gctgtggaagctgcctgcactaatgttccggcgttatttcttgatgtctctgaccagaca cccatcaacagtattattttctcccatgaagacggtacgcgactgggcgtggagcatctg gtcgcattgggtcaccagcaaatcgcgctgttagcgggcccattaagttctgtctcggcg cgtctgcgtctggctggctggcataaatTtctcactcgcaatcaaattcagccgatagcg gaacgggaaggcgactggagtgccatgtccggttttcaacaaaccatgcaaatgctgaat gagggcatcgttcccactgcgatgctggttgccaacgatcagatggcgctgggcgcaatg cgcgccattaccgagtccgggctgcgcgttggtgcggatatctcggtagtgggatacgac gataccgaagacagctcatgttatatcccgccgtcaaccaccatcaaacaggattttcgc ctgctggggcaaaccagcgtggaccgcttgctgcaactctctcagggccaggcggtgaag ggcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccctggcgcccaatacg caaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcc cgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggc accccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggata acaatttcacacaggaaacagctatgaccatgattacggattcactggccgtcgttttac aacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatcccc ctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgc gcagcctgaatggcgaatggcgctttgcctggtttccggcaccagaagcggtgccggaaa gctggctggagtgcgatcttcctgaggccgatactgtcgtcgtcccctcaaactggcaga tgcacggttacgatgcgcccatctacaccaacgtaacctatcccattacggtcaatccgc cgtttgttcccacggagaatccgacgggttgttactcgctcacatttaatgttgatgaaa gctggctacaggaaggccagacgcgaattatttttgatggcgttaactcggcgtttcatc tgtggtgcaacgggcgctgggtcggttacggccaggacagtcgtttgccgtctgaatttg acctgagcgcatttttacgcgccggagaaaaccgcctcgcggtgatggtgctgcgttgga gtgacggcagttatctggaagatcaggatatgtggcggatgagcggcattttccgtgacg tctcgttgctgcataaaccgactacacaaatcagcgatttccatgttgccactcgcttta atgatgatttcagccgcgctgtactggaggctgaagttcagatgtgcggcgagttgcgtg actacctacgggtaacagtttctttatggcagggtgaaacgcaggtcgccagcggcaccg cgcctttcggcggtgaaattatcgatgagcgtggtggttatgccgatcgcgtcacactac gtctgaacgtcgaaaacccgaaactgtggagcgccgaaatcccgaatctctatcgtgcgg tggttgaactgcacaccgccgacggcacgctgattgaagcagaagcctgcgatgtcggtt tccgcgaggtgcggattgaaaatggtctgctgctgctgaacggcaagccgttgctgattc gaggcgttaaccgtcacgagcatcatcctctgcatggtcaggtcatggatgagcagacga tggtgcaggatatcctgctgatgaagcagaacaactttaacgccgtgcgctgttcgcatt atccgaaccatccgctgtggtacacgctgtgcgaccgctacggcctgtatgtggtggatg aagccaatattgaaacccacggcatggtgccaatgaatcgtctgaccgatgatccgcgct ggctaccggcgatgagcgaacgcgtaacgcgaatggtgcagcgcgatcgtaatcacccga gtgtgatcatctggtcgctggggaatgaatcaggccacggcgctaatcacgacgcgctgt atcgctggatcaaatctgtcgatccttcccgcccggtgcagtatgaaggcggcggagccg acaccacggccaccgatattatttgcccgatgtacgcgcgcgtggatgaagaccagccct tcccggctgtgccgaaatggtccatcaaaaaatggctttcgctacctggagagacgcgcc cgctgatcctttgcgaatacgcccacgcgatgggtaacagtcttggcggtttcgctaaat [Part of this file has been deleted for brevity] tgttcggtttattctttttcttttacttttttatcatgggagcctacttcccgtttttcc cgatttggctacatgacatcaaccatatcagcaaaagtgatacgggtattatttttgccg ctatttctctgttctcgctattattccaaccgctgtttggtctgctttctgacaaactcg ggctgcgcaaatacctgctgtggattattaccggcatgttagtgatgtttgcgccgttct ttatttttatcttcgggccactgttacaatacaacattttagtaggatcgattgttggtg gtatttatctaggcttttgttttaacgccggtgcgccagcagtagaggcatttattgaga aagtcagccgtcgcagtaatttcgaatttggtcgcgcgcggatgtttggctgtgttggct gggcgctgtgtgccTcgattgtcggcatcatgttcaccatcaataatcagtttgttttct ggctgggctctggctgtgcactcatcctcgccgttttactctttttcgccaaaacggatg cgccctcttctgccacggttgccaatgcggtaggtgccaaccattcggcatttagcctta agctggcactggaactgttcagacagccaaaactgtggtttttgtcactgtatgttattg gcgtttcctgcacctacgatgtttttgaccaacagtttgctaatttctttacttcgttct ttgctaccggtgaacagggtacgcgggtatttggctacgtaacgacaatgggcgaattac ttaacgcctcgattatgttctttgcgccactgatcattaatcgcatcggtgggaaaaacg ccctgctgctggctggcactattatgtctgtacgtattattggctcatcgttcgccacct cagcgctggaagtggttattctgaaaacgctgcatatgtttgaagtaccgttcctgctgg tgggctgctttaaatatattaccagccagtttgaagtgcgtttttcagcgacgatttatc tggtctgtttctgcttctttaagcaactggcgatgatttttatgtctgtactggcgggca atatgtatgaaagcatcggtttccagggcgcttatctggtgctgggtctggtggcgctgg gcttcaccttaatttccgtgttcacgcttagcggccccggcccgctttccctgctgcgtc gtcaggtgaatgaagtcgcttaagcaatcaatgtcggatgcggcgcgacgcttatccgac caacatatcataacggagtgatcgcattgaacatgccaatgaccgaaagaataagagcag gcaagctatttaccgatatgtgcgaaggcttaccggaaaaaagacttcgtgggaaaacgt taatgtatgagtCtaatcactcgcatccatcagaagttgaaaaaagagaaagcctgatta aagaaatgtttgccacggtaggggaaaacgcctgggCagaaccgcctgtctatttctctt acggttccaacatccatataggccgcaatttttatgcaaatttcaatttaaccattgtcg atgactacacggtaacaatcggtgataacgtactgattgcacccaacgttactctttccg ttacgggacaccctgtacaccatgaattgagaaaaaacggcgagatgtactcttttccga taacgattggcaataacgtctggatcggaagtcatgtggttattaatccaggcgtcacca tcggggataattctgttattggcgcgggtagtatcgtcacaaaagacattccaccaaacg tcgtggcggctggcgttccttgtcgggttattcgcgaaataaacgaccgggataagcact attatttcaaagattataaagttgaatcgtcagtttaaattataaaaattgcctgatacg ctgcgcttatcaggcctacaagttcagcgatctacattagccgcatccggcatgaacaaa gcgcaggaacaagcgtcgcatcatgcctctttgacccacagctgcggaaaacgtactggt gcaaaacgcagggttatgatcatcagcccaacgacgcacagcgcatgaaatgcccagtcc atcaggtaattgccgctgatactacgcagcacgccagaaaaccacggggcaagcccggcg atgataaaaccgattccctgcataaacgccaccagcttgccagcaatagccggttgcaca gagtgatcgagcgccagcagcaaacagagcggaaacgcgccgcccagacctaacccacac accatcgcccacaataccggcaattgcatcggcagccagataaagccgcagaaccccacc agttgtaacaccagcgccagcattaacagtttgcgccgatcctgatggcgagccatagca ggcatcagcaaagctcctgcggcttgcccaagcgtcatcaatgccagtaaggaaccgctg tactgcgcgctggcaccaatctcaatatagaaagcgggtaaccaggcaatcaggctggcg taaccgccgttaatcagaccgaagtaaacacccagcgtccacgcgcggggagtgaatacc acgcgaaccggagtggttgttgtcttgtgggaagaggcgacctcgcgggcgctttgccac caccaggcaaagagcgcaacaacggcaggcagcgccaccaggcgagtgtttgataccagg tttcgctatgttgaactaaccagggcgttatggcggcaccaagcccaccgccgcccatca gagccgcggaccacagccccatcaccagtggcgtgcgctgctgaaaccgccgtttaatca ccgaagcatcaccgcctgaatgatgccgatccccaccccaccaagcagtgcgctgctaag cagcagcgcactttgcgggtaaagctcacgcatcaatgcaccgacggcaatcagcaacag actgatggcgacactgcgacgttcgctgacatgctgatgaagccagcttccggccagcgc cagcccgcccatggtaaccaccggcagagcggtcgac |
The output is a sequence file with 5 substitutions relative to the original sequence.
The qualifiers allow the number, size and type of mutation to be controlled.
The "size" of mutation may be set as following:
If the sequence is nucleic, the codon and block-sized operations can optionally be done in-frame. This causes the minimum block size to be set to 3 and the randomly chosen positions to be multiples of 3.
For each of the above size of sequence it can produce the effects of any of the following types of mutation at a randomly chosen position:
The input and output sequences may not differ if only a few changes are chosen as (for example) one in four nucleic acid point substitutions will not change the sequence.
There is no selection of the types of mutation to produce viable sequence as there would be in a real organism. In particular, there is no attempt to bias mutations of nucleic acid sequences to conform to the C+G ratio in the sequence or to bias the codons in the direction of the frequencies used in the organism. This program emulates mutation, not selection.
This program was named from the acronym of "Mutate Sequence Beyond All Recognition", by analogy with the acronym "fubar" commonly used in the US and UK armed forces.
If you require the mutated sequences to not match some other set of sequences, this set may be specified with the -othersequence qualifier. For example, the mutants should not match the input sequence, or the results of a previous run of this program. msbar ensures the mutants do not match the specified sequences. If a match is found, then the mutation is started again with a fresh copy of the input sequence. If, after 10 such retries, there is still a match to the set of sequence given here, then the matching mutated sequence is written with a warning message.
| Program name | Description |
|---|---|
| shuffleseq | Shuffles a set of sequences maintaining composition |