|
|
nthseq |
Please help by correcting and extending the Wiki pages.
nthseq writes to file a single sequence from an input stream of sequences. The sequence is specified by number, which is the order it appears in the input file. The output file name may be specified.
% nthseq Write to file a single sequence from an input stream of sequences Input (gapped) sequence(s): @eclac.list The number of the sequence to output [1]: 2 output sequence [j01636.fasta]: |
Go to the input files for this example
Go to the output files for this example
Write to file a single sequence from an input stream of sequences
Version: EMBOSS:6.5.0.0
Standard (Mandatory) qualifiers:
[-sequence] seqall (Gapped) sequence(s) filename and optional
format, or reference (input USA)
-number integer [1] The number of the sequence to output
(Integer 1 or more)
[-outseq] seqout [
|
| Qualifier | Type | Description | Allowed values | Default |
|---|---|---|---|---|
| Standard (Mandatory) qualifiers | ||||
| [-sequence] (Parameter 1) |
seqall | (Gapped) sequence(s) filename and optional format, or reference (input USA) | Readable sequence(s) | Required |
| -number | integer | The number of the sequence to output | Integer 1 or more | 1 |
| [-outseq] (Parameter 2) |
seqout | Sequence filename and optional format (output USA) | Writeable sequence | <*>.format |
| Additional (Optional) qualifiers | ||||
| (none) | ||||
| Advanced (Unprompted) qualifiers | ||||
| (none) | ||||
| Associated qualifiers | ||||
| "-sequence" associated seqall qualifiers | ||||
| -sbegin1 -sbegin_sequence |
integer | Start of each sequence to be used | Any integer value | 0 |
| -send1 -send_sequence |
integer | End of each sequence to be used | Any integer value | 0 |
| -sreverse1 -sreverse_sequence |
boolean | Reverse (if DNA) | Boolean value Yes/No | N |
| -sask1 -sask_sequence |
boolean | Ask for begin/end/reverse | Boolean value Yes/No | N |
| -snucleotide1 -snucleotide_sequence |
boolean | Sequence is nucleotide | Boolean value Yes/No | N |
| -sprotein1 -sprotein_sequence |
boolean | Sequence is protein | Boolean value Yes/No | N |
| -slower1 -slower_sequence |
boolean | Make lower case | Boolean value Yes/No | N |
| -supper1 -supper_sequence |
boolean | Make upper case | Boolean value Yes/No | N |
| -scircular1 -scircular_sequence |
boolean | Sequence is circular | Boolean value Yes/No | N |
| -sformat1 -sformat_sequence |
string | Input sequence format | Any string | |
| -iquery1 -iquery_sequence |
string | Input query fields or ID list | Any string | |
| -ioffset1 -ioffset_sequence |
integer | Input start position offset | Any integer value | 0 |
| -sdbname1 -sdbname_sequence |
string | Database name | Any string | |
| -sid1 -sid_sequence |
string | Entryname | Any string | |
| -ufo1 -ufo_sequence |
string | UFO features | Any string | |
| -fformat1 -fformat_sequence |
string | Features format | Any string | |
| -fopenfile1 -fopenfile_sequence |
string | Features file name | Any string | |
| "-outseq" associated seqout qualifiers | ||||
| -osformat2 -osformat_outseq |
string | Output seq format | Any string | |
| -osextension2 -osextension_outseq |
string | File name extension | Any string | |
| -osname2 -osname_outseq |
string | Base file name | Any string | |
| -osdirectory2 -osdirectory_outseq |
string | Output directory | Any string | |
| -osdbname2 -osdbname_outseq |
string | Database name to add | Any string | |
| -ossingle2 -ossingle_outseq |
boolean | Separate file for each entry | Boolean value Yes/No | N |
| -oufo2 -oufo_outseq |
string | UFO features | Any string | |
| -offormat2 -offormat_outseq |
string | Features format | Any string | |
| -ofname2 -ofname_outseq |
string | Features file name | Any string | |
| -ofdirectory2 -ofdirectory_outseq |
string | Output directory | Any string | |
| General qualifiers | ||||
| -auto | boolean | Turn off prompts | Boolean value Yes/No | N |
| -stdout | boolean | Write first file to standard output | Boolean value Yes/No | N |
| -filter | boolean | Read first file from standard input, write first file to standard output | Boolean value Yes/No | N |
| -options | boolean | Prompt for standard and additional values | Boolean value Yes/No | N |
| -debug | boolean | Write debug output to program.dbg | Boolean value Yes/No | N |
| -verbose | boolean | Report some/full command line options | Boolean value Yes/No | Y |
| -help | boolean | Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose | Boolean value Yes/No | N |
| -warning | boolean | Report warnings | Boolean value Yes/No | Y |
| -error | boolean | Report errors | Boolean value Yes/No | Y |
| -fatal | boolean | Report fatal errors | Boolean value Yes/No | Y |
| -die | boolean | Report dying program messages | Boolean value Yes/No | Y |
| -version | boolean | Report version number and exit | Boolean value Yes/No | N |
The input is a standard EMBOSS sequence query (also known as a 'USA').
Major sequence database sources defined as standard in EMBOSS installations include srs:embl, srs:uniprot and ensembl
Data can also be read from sequence output in any supported format written by an EMBOSS or third-party application.
The input format can be specified by using the command-line qualifier -sformat xxx, where 'xxx' is replaced by the name of the required format. The available format names are: gff (gff3), gff2, embl (em), genbank (gb, refseq), ddbj, refseqp, pir (nbrf), swissprot (swiss, sw), dasgff and debug.
See: http://emboss.sf.net/docs/themes/SequenceFormats.html for further information on sequence formats.
#Formerly ECLAC tembl:J01636 #Formerly ECLACA tembl:X51872 #Formerly ECLACI tembl:V00294 #Formerly ECLACY tembl:V00295 #Formerly ECLACZ tembl:V00296 |
The output is a standard EMBOSS sequence file.
The results can be output in one of several styles by using the command-line qualifier -osformat xxx, where 'xxx' is replaced by the name of the required format. The available format names are: embl, genbank, gff, pir, swiss, dasgff, debug, listfile, dbmotif, diffseq, excel, feattable, motif, nametable, regions, seqtable, simple, srs, table, tagseq.
See: http://emboss.sf.net/docs/themes/SequenceFormats.html for further information on sequence formats.
The output is the specified ordinal sequence from the input USA.
In the example, the second sequence from the input file will be written out to the specified output file.
>X51872 X51872.1 Escherichia coli lacA gene for thiogalactoside transacetylase gtgaatgaagtcgcttaagcaatcaatgtcggatgcggcgcgacgcttatccgaccaaca tatcataacggagtgatcgcattgaacatgccaatgaccgaaagaataagagcaggcaag ctatttaccgatatgtgcgaaggcttaccggaaaaaagacttcgtgggaaaacgttaatg tatgagtttaatcactcgcatccatcagaagttgaaaaaagagaaagcctgattaaagaa atgtttgccacggtaggggaaaacgcctgggtagaaccgcctgtctatttctcttacggt tccaacatccatataggccgcaatttttatgcaaatttcaatttaaccattgtcgatgac tacacggtaacaatcggtgataacgtactgattgcacccaacgttactctttccgttacg ggacaccctgtacaccatgaattgagaaaaaacggcgagatgtactcttttccgataacg attggcaataacgtctggatcggaagtcatgtggttattaatccaggcgtcaccatcggg gataattctgttattggcgcgggtagtatcgtcacaaaagacattccaccaaacgtcgtg gcggctggcgttccttgtcgggttattcgcgaaataaacgaccgggataagcactattat ttcaaagattataaagttgaatcgtcagtttaaattataaaaattgcctgatacgctgcg cttatcaggcctacaagttcagcgatctacattagccgcatccggcatgaacaaagcgca ggaacaagcgtcgcatcatgcctctttgacccacagctgcggaaaacgtactggtgcaaa acgcagggttatgatcatcagcccaacgacgcacagcgcatgaaatgcccagtccatcag gtaattgccgctgatactacgcagcacgccagaaaaccacggggcaagcccggcgatgat aaaaccgattccctgcataaacgccaccagcttgccagcaatagccggttgcacagagtg atcgagcgccagcagcaaacagagcggaaacgcgccgcccagacctaacccacacaccat cgcccacaataccggcaattgcatcggcagccagataaagccgcagaaccccaccagttg taacaccagcgccagcattaacagtttgcgccgatcctgatggcgagccatagcaggcat cagcaaagctcctgcggcttgcccaagcgtcatcaatgccagtaaggaaccgctgtactg cgcgctggcaccaatctcaatatagaaagcgggtaaccaggcaatcaggctggcgtaacc gccgttaatcagaccgaagtaaacacccagcgtccacgcgcggggagtgaataccacgcg aaccggagtggttgttgtcttgtgggaagaggcgacctcgcgggcgctttgccaccacca ggcaaagagcgcaacaacggcaggcagcgccaccaggcgagtgtttgataccaggtttcg ctatgttgaactaaccagggcgttatggcggcaccaagcccaccgccgcccatcagagcc gcggaccacagccccatcaccagtggcgtgcgctgctgaaaccgccgtttaatcaccgaa gcatcaccgcctgaatgatgccgatccccaccccaccaagcagtgcgctgctaagcagca gcgcactttgcgggtaaagctcacgcatcaatgcaccgacggcaatcagcaacagactga tggcgacactgcgacgttcgctgacatgctgatgaagccagcttccggccagcgccagcc cgcccatggtaaccaccggcagagcggtcgac |
In EMBOSS, when an application has to write out many sequences, they are typically all written to a single file. This default behaviour can be changed by using the qualifier -ossingle which forces each sequence to be written to its own file.
The program seqretsplit will take a file containing many sequences and will output many files, each containing one sequence. However you have no choice over the naming of the files - they are named after the ID name fo the sequence they contain.
It may be useful to use this application in a small script that extracts all sequences from a multiple sequence file and explicitly names the output files in the way that you require.
For example:
#!/usr/local/bin/perl -w
if ($#ARGV !=1) {
die "Usage: scriptname in out\n";
}
$count=1;
@list = `infoseq $ARGV[0] -auto -only -name`;
while ($count <= $#list+1) {
system("nthseq -auto $ARGV[0] -n $count $ARGV[1]-$count.seq");
$count++;
}
| Program name | Description |
|---|---|
| aligncopy | Read and write alignments |
| aligncopypair | Read and write pairs from alignments |
| biosed | Replace or delete sequence sections |
| codcopy | Copy and reformat a codon usage table |
| cutseq | Remove a section from a sequence |
| degapseq | Remove non-alphabetic (e.g. gap) characters from sequences |
| descseq | Alter the name or description of a sequence |
| entret | Retrieve sequence entries from flatfile databases and files |
| extractalign | Extract regions from a sequence alignment |
| extractfeat | Extract features from sequence(s) |
| extractseq | Extract regions from a sequence |
| featcopy | Read and write a feature table |
| featmerge | Merge two overlapping feature tables |
| featreport | Read and write a feature table |
| feattext | Return a feature table original text |
| listor | Write a list file of the logical OR of two sets of sequences |
| makenucseq | Create random nucleotide sequences |
| makeprotseq | Create random protein sequences |
| maskambignuc | Mask all ambiguity characters in nucleotide sequences with N |
| maskambigprot | Mask all ambiguity characters in protein sequences with X |
| maskfeat | Write a sequence with masked features |
| maskseq | Write a sequence with masked regions |
| newseq | Create a sequence file from a typed-in sequence |
| nohtml | Remove mark-up (e.g. HTML tags) from an ASCII text file |
| noreturn | Remove carriage return from ASCII files |
| nospace | Remove whitespace from an ASCII text file |
| notab | Replace tabs with spaces in an ASCII text file |
| notseq | Write to file a subset of an input stream of sequences |
| nthseqset | Read and write (return) one set of sequences from many |
| pasteseq | Insert one sequence into another |
| revseq | Reverse and complement a nucleotide sequence |
| seqcount | Read and count sequences |
| seqret | Read and write (return) sequences |
| seqretsetall | Read and write (return) many sets of sequences |
| seqretsplit | Read sequences and write them to individual files |
| sizeseq | Sort sequences by size |
| skipredundant | Remove redundant sequences from an input set |
| skipseq | Read and write (return) sequences, skipping first few |
| splitsource | Split sequence(s) into original source sequences |
| splitter | Split sequence(s) into smaller sequences |
| trimest | Remove poly-A tails from nucleotide sequences |
| trimseq | Remove unwanted characters from start and end of sequence(s) |
| trimspace | Remove extra whitespace from an ASCII text file |
| union | Concatenate multiple sequences into a single sequence |
| vectorstrip | Remove vectors from the ends of nucleotide sequence(s) |
| yank | Add a sequence reference (a full USA) to a list file |
The program seqretsplit will take a file containing many sequences and will output many files, each containing one sequence. However you have no choice over the naming of the files - they are named after the ID name fo the sequence they contain.
Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author.