|
|
nthseq |
Please help by correcting and extending the Wiki pages.
nthseq writes to file a single sequence from an input stream of sequences. The sequence is specified by number, which is the order it appears in the input file. The output file name may be specified.
% nthseq Write to file a single sequence from an input stream of sequences Input (gapped) sequence(s): @eclac.list The number of the sequence to output [1]: 2 output sequence [j01636.fasta]: |
Go to the input files for this example
Go to the output files for this example
Standard (Mandatory) qualifiers:
[-sequence] seqall (Gapped) sequence(s) filename and optional
format, or reference (input USA)
-number integer [1] The number of the sequence to output
(Integer 1 or more)
[-outseq] seqout [
|
| Qualifier | Type | Description | Allowed values | Default |
|---|---|---|---|---|
| Standard (Mandatory) qualifiers | ||||
| [-sequence] (Parameter 1) |
seqall | (Gapped) sequence(s) filename and optional format, or reference (input USA) | Readable sequence(s) | Required |
| -number | integer | The number of the sequence to output | Integer 1 or more | 1 |
| [-outseq] (Parameter 2) |
seqout | Sequence filename and optional format (output USA) | Writeable sequence | <*>.format |
| Additional (Optional) qualifiers | ||||
| (none) | ||||
| Advanced (Unprompted) qualifiers | ||||
| (none) | ||||
#Formerly ECLAC tembl:J01636 #Formerly ECLACA tembl:X51872 #Formerly ECLACI tembl:V00294 #Formerly ECLACY tembl:V00295 #Formerly ECLACZ tembl:V00296 |
In the example, the second sequence from the input file will be written out to the specified output file.
>X51872 X51872.1 Escherichia coli lacA gene for thiogalactoside transacetylase gtgaatgaagtcgcttaagcaatcaatgtcggatgcggcgcgacgcttatccgaccaaca tatcataacggagtgatcgcattgaacatgccaatgaccgaaagaataagagcaggcaag ctatttaccgatatgtgcgaaggcttaccggaaaaaagacttcgtgggaaaacgttaatg tatgagtttaatcactcgcatccatcagaagttgaaaaaagagaaagcctgattaaagaa atgtttgccacggtaggggaaaacgcctgggtagaaccgcctgtctatttctcttacggt tccaacatccatataggccgcaatttttatgcaaatttcaatttaaccattgtcgatgac tacacggtaacaatcggtgataacgtactgattgcacccaacgttactctttccgttacg ggacaccctgtacaccatgaattgagaaaaaacggcgagatgtactcttttccgataacg attggcaataacgtctggatcggaagtcatgtggttattaatccaggcgtcaccatcggg gataattctgttattggcgcgggtagtatcgtcacaaaagacattccaccaaacgtcgtg gcggctggcgttccttgtcgggttattcgcgaaataaacgaccgggataagcactattat ttcaaagattataaagttgaatcgtcagtttaaattataaaaattgcctgatacgctgcg cttatcaggcctacaagttcagcgatctacattagccgcatccggcatgaacaaagcgca ggaacaagcgtcgcatcatgcctctttgacccacagctgcggaaaacgtactggtgcaaa acgcagggttatgatcatcagcccaacgacgcacagcgcatgaaatgcccagtccatcag gtaattgccgctgatactacgcagcacgccagaaaaccacggggcaagcccggcgatgat aaaaccgattccctgcataaacgccaccagcttgccagcaatagccggttgcacagagtg atcgagcgccagcagcaaacagagcggaaacgcgccgcccagacctaacccacacaccat cgcccacaataccggcaattgcatcggcagccagataaagccgcagaaccccaccagttg taacaccagcgccagcattaacagtttgcgccgatcctgatggcgagccatagcaggcat cagcaaagctcctgcggcttgcccaagcgtcatcaatgccagtaaggaaccgctgtactg cgcgctggcaccaatctcaatatagaaagcgggtaaccaggcaatcaggctggcgtaacc gccgttaatcagaccgaagtaaacacccagcgtccacgcgcggggagtgaataccacgcg aaccggagtggttgttgtcttgtgggaagaggcgacctcgcgggcgctttgccaccacca ggcaaagagcgcaacaacggcaggcagcgccaccaggcgagtgtttgataccaggtttcg ctatgttgaactaaccagggcgttatggcggcaccaagcccaccgccgcccatcagagcc gcggaccacagccccatcaccagtggcgtgcgctgctgaaaccgccgtttaatcaccgaa gcatcaccgcctgaatgatgccgatccccaccccaccaagcagtgcgctgctaagcagca gcgcactttgcgggtaaagctcacgcatcaatgcaccgacggcaatcagcaacagactga tggcgacactgcgacgttcgctgacatgctgatgaagccagcttccggccagcgccagcc cgcccatggtaaccaccggcagagcggtcgac |
In EMBOSS, when an application has to write out many sequences, they are typically all written to a single file. This default behaviour can be changed by using the qualifier -ossingle which forces each sequence to be written to its own file.
The program seqretsplit will take a file containing many sequences and will output many files, each containing one sequence. However you have no choice over the naming of the files - they are named after the ID name fo the sequence they contain.
It may be useful to use this application in a small script that extracts all sequences from a multiple sequence file and explicitly names the output files in the way that you require.
For example:
#!/usr/local/bin/perl -w
if ($#ARGV !=1) {
die "Usage: scriptname in out\n";
}
$count=1;
@list = `infoseq $ARGV[0] -auto -only -name`;
while ($count <= $#list+1) {
system("nthseq -auto $ARGV[0] -n $count $ARGV[1]-$count.seq");
$count++;
}
| Program name | Description |
|---|---|
| aligncopy | Reads and writes alignments |
| aligncopypair | Reads and writes pairs from alignments |
| biosed | Replace or delete sequence sections |
| codcopy | Copy and reformat a codon usage table |
| cutseq | Removes a section from a sequence |
| degapseq | Removes non-alphabetic (e.g. gap) characters from sequences |
| descseq | Alter the name or description of a sequence |
| entret | Retrieves sequence entries from flatfile databases and files |
| extractalign | Extract regions from a sequence alignment |
| extractfeat | Extract features from sequence(s) |
| extractseq | Extract regions from a sequence |
| featcopy | Reads and writes a feature table |
| featreport | Reads and writes a feature table |
| listor | Write a list file of the logical OR of two sets of sequences |
| makenucseq | Create random nucleotide sequences |
| makeprotseq | Create random protein sequences |
| maskambignuc | Masks all ambiguity characters in nucleotide sequences with N |
| maskambigprot | Masks all ambiguity characters in protein sequences with X |
| maskfeat | Write a sequence with masked features |
| maskseq | Write a sequence with masked regions |
| newseq | Create a sequence file from a typed-in sequence |
| nohtml | Remove mark-up (e.g. HTML tags) from an ASCII text file |
| noreturn | Remove carriage return from ASCII files |
| nospace | Remove all whitespace from an ASCII text file |
| notab | Replace tabs with spaces in an ASCII text file |
| notseq | Write to file a subset of an input stream of sequences |
| nthseqset | Reads and writes (returns) one set of sequences from many |
| pasteseq | Insert one sequence into another |
| revseq | Reverse and complement a nucleotide sequence |
| seqret | Reads and writes (returns) sequences |
| seqretsetall | Reads and writes (returns) many sets of sequences |
| seqretsplit | Reads sequences and writes them to individual files |
| sizeseq | Sort sequences by size |
| skipredundant | Remove redundant sequences from an input set |
| skipseq | Reads and writes (returns) sequences, skipping first few |
| splitsource | Split sequence(s) into original source sequences |
| splitter | Split sequence(s) into smaller sequences |
| trimest | Remove poly-A tails from nucleotide sequences |
| trimseq | Remove unwanted characters from start and end of sequence(s) |
| trimspace | Remove extra whitespace from an ASCII text file |
| union | Concatenate multiple sequences into a single sequence |
| vectorstrip | Removes vectors from the ends of nucleotide sequence(s) |
| yank | Add a sequence reference (a full USA) to a list file |
The program seqretsplit will take a file containing many sequences and will output many files, each containing one sequence. However you have no choice over the naming of the files - they are named after the ID name fo the sequence they contain.