|
|
seqretsplit |
Please help by correcting and extending the Wiki pages.
seqretsplit is a variant of the standard program for reading and writing sequences, seqret. It performs exactly the same function except that when it reads more than one sequence, it writes each sequence to an individual file. In all other respects, skipseq is the same as seqret. Its main use is therefore to split a file containing multiple sequences into many files, each containing one sequence. There are many options built-in into EMBOSS for detailed specification of the input and output sequences, for example the sequence type and file format. Optionally, feature information will be read and written.
% seqretsplit tembl:m1190* Reads sequences and writes them to individual files output sequence(s) [m11903.fasta]: |
Go to the input files for this example
Go to the output files for this example
The specification of the output file is not used in this case.
At some point this ought to change and you will not be prompted for the output file at all.
Standard (Mandatory) qualifiers:
[-sequence] seqall (Gapped) sequence(s) filename and optional
format, or reference (input USA)
[-outseq] seqoutall [
|
| Qualifier | Type | Description | Allowed values | Default |
|---|---|---|---|---|
| Standard (Mandatory) qualifiers | ||||
| [-sequence] (Parameter 1) |
seqall | (Gapped) sequence(s) filename and optional format, or reference (input USA) | Readable sequence(s) | Required |
| [-outseq] (Parameter 2) |
seqoutall | Sequence set(s) filename and optional format (output USA) | Writeable sequence(s) | <*>.format |
| Additional (Optional) qualifiers | ||||
| (none) | ||||
| Advanced (Unprompted) qualifiers | ||||
| -feature | boolean | Use feature information | Boolean value Yes/No | No |
| -firstonly | boolean | Read one sequence and stop | Boolean value Yes/No | No |
>M11903 M11903.1 Rattus norvegicus androgen-responsive protein precursor (Svf) gene, exons 1 and 1A, alternatively spliced. cctttcaaatagaaactctcgtgaaggctgtctgagaacacaagctcaaggttgtgactg atttcagtgatgccgtcttgaagagggataccgtgctagagaatgactcctgatcaaccc tgaagacttctgcaagcccgaagtcgtgcttccccactctgaactgacatatgttcagga agtagagacgtgcaccgttggatgttctcaaggtaaaaaggaagatttggaagaatgctc tagtgttgttgccttggagaggaccagggaacagtacaagactcctactgagcagagaga aaggagcctgacatttaccgataagaaaggtcatttgccttccaacctgtaggcaaggcc agacaaggaaatatataaaggagaacctcagatcagctctcagtcaagacccttcctgac aagatgagtcccaccgggttcttcctccttacggtgctccttgttctggtgacagaagca gcctcgagggggccccgaggtgagtggcaattttgtgctatgggaaagatgtttgagaac tatgttctcaaaagggagtctgcagaatgctgtgttcccagggcttctccatgaaggaaa cttgagtcttttcaagctttaaccatagtcctactgtgagtctctgtgacttgacaagca acattgctggtaaggagggctgagggggaatgcgggcaacggcctcgggtaacatcctca ttgt |
>M11904 M11904.1 Rattus norvegicus androgen-responsive protein precursor (Svf) gene, exon 2 and complete cds. ggtatctccaaacacagcagctggctctcaacagagagtcctcatgcacaactaatccaa gatacagaaagtggatatagagaatgagacattgttttctctcaacagaaaaattctcac agtcagctgaagacccttatagtgaaaacatgaatctaaagattctggcgagcgggaggg gatcaagttctacctttggggcattcagccgaagtgagaactctcggagtaacttcaaat caaaaagtccaagcagtatcaccagggagaaagtgaatgaggaaagcaggagtgaaatga gtagtaccagcagccattttggtctcaaaatgagaagatctcatggaggaggagaaatga atccctttgaaaccaaagtaaagacccggatcactcgcaaataatgtgttccccggccaa ctgaagacttgagcccaataggcaggtaagtgttatcaccaggtgagggcttacaaacta ctcgtgcctaatccctaggccattgtaggattgtgcacgcagtaaagttgctataagggg aggtatggaaacgacctacaaggcagacaaagatacgagctatactgtgt |
>M11905 M11905.1 Rattus norvegicus androgen-responsive protein precursor (Svf) gene, exon 3. ccgtgcaatctcttcctgtgtccacacagccctgttagaagcaactctctcgttctcaag gccctacctgcaagaactacctttctcttcctccgcccaacaaaggaggaatgtttctgc ttgtgacccaccagagatgaaatatagcagtgtcctgcagtaaaggggggccccagaggc atgggacatacacgcattaatccctccacgtcttccctgtcctacctcacaggttgtcct cgttccctgggtgtcactgaactaagagaagtctatgatgtcttcaggatgcaggatccc acaggtgccccggaaatagtccgtgcttcttatttcctccttacacttgttttctttaag attccggaacctgacaagattcaaatttaaccttttcaataaaaaagatactattctgca tcattatctcctgaaatctcttgcttctgcagtacaggggctgggtgggattcctaaact tgaccagttctgccgttaaaggaagatcccttctgtgccgtatcagagactatttccaga ctctggataga |
One file for each input sequence is written out.
The names of the files it creates are derived from the ID name of the sequence, followed by an extension denoting the format of the sequence. You have no control over the names of the files it writes out.
For example, if the files embl:hsfa11* are read in and the output is specified as wibble.seq, then the following files are expected to be created:
hsfa110.fasta hsfa111.fasta hsfa112.fasta hsfa113.fasta hsfa114.fasta
(No file wibble.seq is created.)
See the documentation for seqret to see the full range of things that you can do when reading and writing sequences.
Some non-EMBOSS programs will accept only single sequences. In such cases seqretsplit is useful for splitting a multiple sequence file into many individual files. Some EMBOSS programs will also read only a single sequence, which may, however, be one of many in a file. You can specify the sequence using the USA filename:sequenceID. Nonetheless, some people feel more comfortable handling one sequence per file, so seqretsplit will be useful to them too.
One file for each input sequence is written. The names of the files it creates are derived from the ID name of the sequence, followed by an extension denoting the format of the sequence. You have no control over the names of the files it writes out. For example, if the files embl:hsfa11* are read in and the output is specified as wibble.seq, then the following files are expected to be created:
hsfa110.fasta hsfa111.fasta hsfa112.fasta hsfa113.fasta hsfa114.fasta
(No file wibble.seq is created.)
This is a side effect of the way sequence output works in EMBOSS. Writing multiple sequences to separate files (the -ossingle qualifier) does this, and seqretsplit has set it automatically on.
| Program name | Description |
|---|---|
| aligncopy | Reads and writes alignments |
| aligncopypair | Reads and writes pairs from alignments |
| biosed | Replace or delete sequence sections |
| codcopy | Copy and reformat a codon usage table |
| cutseq | Removes a section from a sequence |
| degapseq | Removes non-alphabetic (e.g. gap) characters from sequences |
| descseq | Alter the name or description of a sequence |
| entret | Retrieves sequence entries from flatfile databases and files |
| extractalign | Extract regions from a sequence alignment |
| extractfeat | Extract features from sequence(s) |
| extractseq | Extract regions from a sequence |
| featcopy | Reads and writes a feature table |
| featreport | Reads and writes a feature table |
| listor | Write a list file of the logical OR of two sets of sequences |
| makenucseq | Create random nucleotide sequences |
| makeprotseq | Create random protein sequences |
| maskambignuc | Masks all ambiguity characters in nucleotide sequences with N |
| maskambigprot | Masks all ambiguity characters in protein sequences with X |
| maskfeat | Write a sequence with masked features |
| maskseq | Write a sequence with masked regions |
| newseq | Create a sequence file from a typed-in sequence |
| nohtml | Remove mark-up (e.g. HTML tags) from an ASCII text file |
| noreturn | Remove carriage return from ASCII files |
| nospace | Remove all whitespace from an ASCII text file |
| notab | Replace tabs with spaces in an ASCII text file |
| notseq | Write to file a subset of an input stream of sequences |
| nthseq | Write to file a single sequence from an input stream of sequences |
| nthseqset | Reads and writes (returns) one set of sequences from many |
| pasteseq | Insert one sequence into another |
| revseq | Reverse and complement a nucleotide sequence |
| seqret | Reads and writes (returns) sequences |
| seqretsetall | Reads and writes (returns) many sets of sequences |
| sizeseq | Sort sequences by size |
| skipredundant | Remove redundant sequences from an input set |
| skipseq | Reads and writes (returns) sequences, skipping first few |
| splitsource | Split sequence(s) into original source sequences |
| splitter | Split sequence(s) into smaller sequences |
| trimest | Remove poly-A tails from nucleotide sequences |
| trimseq | Remove unwanted characters from start and end of sequence(s) |
| trimspace | Remove extra whitespace from an ASCII text file |
| union | Concatenate multiple sequences into a single sequence |
| vectorstrip | Removes vectors from the ends of nucleotide sequence(s) |
| yank | Add a sequence reference (a full USA) to a list file |
At some point this ought to change and you will not be prompted for the output file at all.