tfextract

 

Wiki

The master copies of EMBOSS documentation are available at http://emboss.open-bio.org/wiki/Appdocs on the EMBOSS Wiki.

Please help by correcting and extending the Wiki pages.

Function

Process TRANSFAC transcription factor database for use by tfscan

Description

tfextract extracts data from the TRANSFAC transcription factor database file site.dat (available from ftp://ftp.ebi.ac.uk/pub/databases/transfac/) for other EMBOSS programs, such as tfscan, that use these data. The data is split up by taxonomic groups and placed in individual files that are stored in the EMBOSS data directory.

Usage

Here is a sample session with tfextract


% tfextract 
Process TRANSFAC transcription factor database for use by tfscan
Transfac database sites file: site.dat

Go to the input files for this example
Go to the output files for this example

Command line arguments

   Standard (Mandatory) qualifiers:
  [-infile]            infile     Transfac database sites file

   Additional (Optional) qualifiers: (none)
   Advanced (Unprompted) qualifiers: (none)
   Associated qualifiers: (none)
   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write first file to standard output
   -filter             boolean    Read first file from standard input, write
                                  first file to standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages

Qualifier Type Description Allowed values Default
Standard (Mandatory) qualifiers
[-infile]
(Parameter 1)
infile Transfac database sites file Input file Required
Additional (Optional) qualifiers
(none)
Advanced (Unprompted) qualifiers
(none)

Input file format

It reads in the TRANSFAC file site.dat available from:

ftp://ftp.ebi.ac.uk/pub/databases/transfac/

Input files for usage example

File: site.dat

AC  R00077
XX
ID  HS$ALBU_01
XX
DT  20.06.90 (created); ewi.
DT  24.08.95 (updated); hiwi.
XX
TY  D
XX
DE  albumin; Gene: G000188.
XX
SQ  tGGTTAGtaattactaa.
XX
SF  -363 
ST  -338 
XX
BF  T00368; HNF-1A;Quality: 1; Species: human, Homo sapiens.
BF  T00369; HNF-1;Quality: 1; Species: rat, Rattus norvegicus.
BF  T01950; HNF-1B;Quality: 1; Species: human, Homo sapiens.
BF  T01951; HNF-1C;Quality: 1; Species: human, Homo sapiens.
XX
OS  human, Homo sapiens
OC  eukaryota; animalia; metazoa; chordata; vertebrata; 
OC  tetrapoda; mammalia; eutheria; primates
XX
SO  0103; Hep3B
SO  0289; rl
XX
MM  gel retardation
MM  direct gel shift
MM  DNase I footprinting
MM  gel shift competition
MM  affinity chromatography
MM  methylation interference
XX
DR  EMBL: M13075; HSALBEX1(695:711).
XX
RN  [1]
RA  Frain M., Swart G., Monaci P., Nicosia A., Staempfli 
RA  S., Frank R., Cortese R.
RT  The liver-specific transcription factor LF-B1 contains 
RT  a highly diverged homeobox DNA binding domain
RL  Cell 59:145-157 (1989).
RN  [2]
RA  Frain M., Hardon E., Ciliberto G., Sala-Trepat J. M.
RT  Binding of a liver-specific factor to the human albumin 
RT  gene promoter and enhancer
RL  Mol. Cell. Biol. 10:991-999 (1990).
XX
//


  [Part of this file has been deleted for brevity]

DR  EMBL: U11854; MM11854(1931:1941).
XX
RN  [1]
RA  Feinman R., Qiu W. Q., Pearse R. N., Nikolajczyk B. 
RA  S., Sen R., Sheffery M., Ravetch J. V.
RT  PU.1 and an HLH family member contribute to the myeloid-specific 
RT  transcription of the FcgammaRIIIA promoter
RL  EMBO J. 13:3852-3860 (1994).
XX
//
AC  R04413
XX
ID  MOUSE$FCGR3A_02
XX
DT  14.05.97 (created); ewi.
DT  14.05.97 (updated); ewi.
XX
TY  D
XX
DE  FcgammaRIIIA (low-affinity Fc receptor IIIA for IgG); Gene: G001014.
XX
SQ  TTCCTC.
XX
EL  MRR
XX
SF  -48 
ST  -43 
XX
BF  T00702; PU.1;Quality: 3; Species: mouse, Mus musculus.
XX
OS  mouse, Mus musculus
OC  eukaryota; animalia; metazoa; chordata; vertebrata; 
OC  tetrapoda; mammalia; eutheria; rodentia; myomorpha; muridae; murinae
XX
SO  0495; A20
SO  0848; RAW264.7
XX
MM  direct gel shift
MM  methylation interference
MM  supershift (antibody binding)
XX
DR  EMBL: U11854; MM11854(1971:1976).
XX
RN  [1]
RA  Feinman R., Qiu W. Q., Pearse R. N., Nikolajczyk B. 
RA  S., Sen R., Sheffery M., Ravetch J. V.
RT  PU.1 and an HLH family member contribute to the myeloid-specific 
RT  transcription of the FcgammaRIIIA promoter
RL  EMBO J. 13:3852-3860 (1994).
XX
//

Output file format

Output files for usage example

File: tffungi

Y$ADH1_02            ACAATATGGACTTCCTCTTTTCTGG R04140 T00322; GCR1;Quality: 2; Species: yeast, Saccharomyces cerevisiae.

File: tfinsect


File: tfvertebrate

HS$ALBU_01           tGGTTAGtaattactaa R00077 T01951; HNF-1C;Quality: 1; Species: human, Homo sapiens.
HS$ALBU_02           TTGGCA R00078 T00599; NF-1/L;Quality: 6; Species: rat, Rattus norvegicus.
HS$ALBU_03           TGGCA R00079 T00599; NF-1/L;Quality: 6; Species: rat, Rattus norvegicus.
HS$ALBU_04           TTAATAAT R00080 T00015; AFP1;Quality: 6; Species: human, Homo sapiens.
HS$ALBU_05           TCTAGTTAATAATCTACAAT R00081 T00369; HNF-1;Quality: 4; Species: rat, Rattus norvegicus.
MOUSE$FCGR3A_01      GTCTGCTGACC R04412 T00874; USF;Quality: 2; Species: human, Homo sapiens.
MOUSE$FCGR3A_02      TTCCTC R04413 T00702; PU.1;Quality: 3; Species: mouse, Mus musculus.

File: tfplant


File: tfother


The output from tfextract is a set of files in the emboss/data directory containing reformatted sites from the transfac database.

These files are used by the tfscan program to search for TRANSFAC sites in sequences.

Data files

EMBOSS data files are distributed with the application and stored in the standard EMBOSS data directory, which is defined by the EMBOSS environment variable EMBOSS_DATA.

To see the available EMBOSS data files, run:

% embossdata -showall

To fetch one of the data files (for example 'Exxx.dat') into your current directory for you to inspect or modify, run:


% embossdata -fetch -file Exxx.dat

Users can provide their own data files in their own directories. Project specific files can be put in the current directory, or for tidier directory listings in a subdirectory called ".embossdata". Files for all EMBOSS runs can be put in the user's home directory, or again in a subdirectory called ".embossdata".

The directories are searched in the following order:

Notes

The TRANSFAC Database is a commercial database of eukaryotic cis-acting regulatory DNA elements and trans-acting factors. It covers the whole range from yeast to human. An old public domain version is available at: ftp://ftp.ebi.ac.uk/pub/databases/transfac/transfac32.tar.Z

TRANSFAC started in 1988 with a printed compilation (Nucleic Acids Res. 16: 1879-1902, 1988) and was transferred into computer-readable format in 1990 (BioTechForum - Advances in Molecular Genetics (J. Collins, A.J. Driesel, eds.) 4:95-108, 1991). The basic structures of Table 1 and 2 of the compilation were taken as the core of the emergent database. The aim of the early compilation as well as of the TRANSFAC database is: 1. to guide through a meanwhile overwhelming amount of data in a field which is connected to nearly all areas of modern molecular biology; 2. to map the regulatory sites in the individual genes and, ultimately, in the genome(s) as a whole; 3. to develop a tool for the identification of regulatory elements in newly unravelled genomic sequences; 4. to provide a basis for a more comprehensive understanding of how the genome governs transcriptional control.

The program tfextract extracts data from the TRANSFAC database file site.dat. This file contains information on individual (putatively) regulatory protein binding sites. About half of these refer to sites within eukaryotic genes. Just under half of them resulted from mutagenesis studies, in vitro selection procedures starting from random oligonucleotide mixtures or from specific theoretical considerations. And finally, there are about 5% with consensus binding sequences given in the IUPAC code, many of them being taken from the compilation of Faisst and Meyer (Nucleic Acids Res. 20:3-26, 1992). A number of consensi have been generated by the TRANSFAC team, generally derived from the profiles stored in the MATRIX table.

The data is split up by taxonomic groups:

and placed in individual files:

These files are stored in the EMBOSS data directory, see Data Files below.

References

Warnings

None.

Diagnostic Error Messages

None.

Exit status

It always exits with a status of 0.

Known bugs

None.

See also

Program name Description
aaindexextract Extract amino acid property data from AAINDEX
cutgextract Extract codon usage tables from from CUTG database
jaspextract Extract data from JASPAR
printsextract Extract data from PRINTS database for use by pscan
prosextract Processes the PROSITE motif database for use by patmatmotifs
rebaseextract Process the REBASE database for use by restriction enzyme applications

Author(s)

Alan Bleasby (ajb © ebi.ac.uk)
European Bioinformatics Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge CB10 1SD, UK

History

Written Summer 2000 - Alan Bleasby.

Target users

This program is intended to be used by administrators responsible for software and database installation and maintenance.

Comments

None