trimseq

 

Wiki

The master copies of EMBOSS documentation are available at http://emboss.open-bio.org/wiki/Appdocs on the EMBOSS Wiki.

Please help by correcting and extending the Wiki pages.

Function

Remove unwanted characters from start and end of sequence(s)

Description

trimseq reads one or more sequences and writes the same sequences out, but removing any regions at the start and / or end that contain unwanted characters. These include gap characters (where occur the sequences have been aligned), X's and N's (in nucleotide sequences), *'s (optionally) and (optionally) IUPAC ambiguity codes.

Usage

Here is a sample session with trimseq


% trimseq untrimmed.seq trim1.seq -window 1 -percent 100 
Remove unwanted characters from start and end of sequence(s)

Go to the input files for this example
Go to the output files for this example

Example 2


% trimseq untrimmed.seq trim2.seq -window 5 -percent 40 
Remove unwanted characters from start and end of sequence(s)

Go to the output files for this example

Example 3


% trimseq untrimmed.seq trim3.seq -window 5 -percent 50 
Remove unwanted characters from start and end of sequence(s)

Go to the output files for this example

Example 4


% trimseq untrimmed.seq trim4.seq -window 5 -percent 50 -strict 
Remove unwanted characters from start and end of sequence(s)

Go to the output files for this example

Example 5


% trimseq untrimmed.seq trim5.seq -window 5 -percent 50 -strict -noright 
Remove unwanted characters from start and end of sequence(s)

Go to the output files for this example

Command line arguments

   Standard (Mandatory) qualifiers:
  [-sequence]          seqall     (Gapped) sequence(s) filename and optional
                                  format, or reference (input USA)
  [-outseq]            seqoutall  [.] Sequence set(s)
                                  filename and optional format (output USA)

   Additional (Optional) qualifiers:
   -window             integer    [1] This determines the size of the region
                                  that is considered when deciding whether the
                                  percentage of ambiguity is greater than the
                                  threshold. A value of 5 means that a region
                                  of 5 letters in the sequence is shifted
                                  along the sequence from the ends and
                                  trimming is done only if there is a greater
                                  or equal percentage of ambiguity than the
                                  threshold percentage. (Any integer value)
   -percent            float      [100.0] This is the threshold of the
                                  percentage ambiguity in the window required
                                  in order to trim a sequence. (Any numeric
                                  value)
   -strict             boolean    [N] In nucleic sequences, trim off not only
                                  N's and X's, but also the nucleotide IUPAC
                                  ambiguity codes M, R, W, S, Y, K, V, H, D
                                  and B. In protein sequences, trim off not
                                  only X's but also B and Z.
   -star               boolean    [N] In protein sequences, trim off not only
                                  X's, but also the *'s

   Advanced (Unprompted) qualifiers:
   -[no]left           boolean    [Y] Trim at the start
   -[no]right          boolean    [Y] Trim at the end

   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin1            integer    Start of each sequence to be used
   -send1              integer    End of each sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -sformat1           string     Input sequence format
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name

   "-outseq" associated qualifiers
   -osformat2          string     Output seq format
   -osextension2       string     File name extension
   -osname2            string     Base file name
   -osdirectory2       string     Output directory
   -osdbname2          string     Database name to add
   -ossingle2          boolean    Separate file for each entry
   -oufo2              string     UFO features
   -offormat2          string     Features format
   -ofname2            string     Features file name
   -ofdirectory2       string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write first file to standard output
   -filter             boolean    Read first file from standard input, write
                                  first file to standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages

Qualifier Type Description Allowed values Default
Standard (Mandatory) qualifiers
[-sequence]
(Parameter 1)
seqall (Gapped) sequence(s) filename and optional format, or reference (input USA) Readable sequence(s) Required
[-outseq]
(Parameter 2)
seqoutall Sequence set(s) filename and optional format (output USA) Writeable sequence(s) <*>.format
Additional (Optional) qualifiers
-window integer This determines the size of the region that is considered when deciding whether the percentage of ambiguity is greater than the threshold. A value of 5 means that a region of 5 letters in the sequence is shifted along the sequence from the ends and trimming is done only if there is a greater or equal percentage of ambiguity than the threshold percentage. Any integer value 1
-percent float This is the threshold of the percentage ambiguity in the window required in order to trim a sequence. Any numeric value 100.0
-strict boolean In nucleic sequences, trim off not only N's and X's, but also the nucleotide IUPAC ambiguity codes M, R, W, S, Y, K, V, H, D and B. In protein sequences, trim off not only X's but also B and Z. Boolean value Yes/No No
-star boolean In protein sequences, trim off not only X's, but also the *'s Boolean value Yes/No No
Advanced (Unprompted) qualifiers
-[no]left boolean Trim at the start Boolean value Yes/No Yes
-[no]right boolean Trim at the end Boolean value Yes/No Yes

Input file format

Normal sequence.

Input files for usage example

File: untrimmed.seq

>myseq
...ttyyyctttctcgactccatcttcgcggtagctgggaccgccgttcagtcgccaatatgc
agctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacggtcg
cccagatcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtcgtgc
tcctggcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggaggccc
tgactaccctggaagtagcaggccgcatgcttggaggtaaagttcatggttccctggccc
gtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaagaaga
agacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtgccca
cctttggcaagaagaagggccccaatgccaactcttaagtcttttgtaattctggctttc
tctaataaaaaagccacttagttca.gnntcynnnnnn

Output file format

Normal sequence file.

Output files for usage example

File: trim1.seq

>myseq
ttyyyctttctcgactccatcttcgcggtagctgggaccgccgttcagtcgccaatatgc
agctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacggtcg
cccagatcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtcgtgc
tcctggcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggaggccc
tgactaccctggaagtagcaggccgcatgcttggaggtaaagttcatggttccctggccc
gtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaagaaga
agacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtgccca
cctttggcaagaagaagggccccaatgccaactcttaagtcttttgtaattctggctttc
tctaataaaaaagccacttagttca-gnntcy

Output files for usage example 2

File: trim2.seq

>myseq
ttyyyctttctcgactccatcttcgcggtagctgggaccgccgttcagtcgccaatatgc
agctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacggtcg
cccagatcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtcgtgc
tcctggcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggaggccc
tgactaccctggaagtagcaggccgcatgcttggaggtaaagttcatggttccctggccc
gtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaagaaga
agacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtgccca
cctttggcaagaagaagggccccaatgccaactcttaagtcttttgtaattctggctttc
tctaataaaaaagccacttagttca-g

Output files for usage example 3

File: trim3.seq

>myseq
ttyyyctttctcgactccatcttcgcggtagctgggaccgccgttcagtcgccaatatgc
agctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacggtcg
cccagatcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtcgtgc
tcctggcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggaggccc
tgactaccctggaagtagcaggccgcatgcttggaggtaaagttcatggttccctggccc
gtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaagaaga
agacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtgccca
cctttggcaagaagaagggccccaatgccaactcttaagtcttttgtaattctggctttc
tctaataaaaaagccacttagttca-gnntcy

Output files for usage example 4

File: trim4.seq

>myseq
ctttctcgactccatcttcgcggtagctgggaccgccgttcagtcgccaatatgcagctc
tttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacggtcgcccag
atcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtcgtgctcctg
gcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggaggccctgact
accctggaagtagcaggccgcatgcttggaggtaaagttcatggttccctggcccgtgct
ggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaagaagaagaca
ggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtgcccaccttt
ggcaagaagaagggccccaatgccaactcttaagtcttttgtaattctggctttctctaa
taaaaaagccacttagttca-gnntc

Output files for usage example 5

File: trim5.seq

>myseq
ctttctcgactccatcttcgcggtagctgggaccgccgttcagtcgccaatatgcagctc
tttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacggtcgcccag
atcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtcgtgctcctg
gcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggaggccctgact
accctggaagtagcaggccgcatgcttggaggtaaagttcatggttccctggcccgtgct
ggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaagaagaagaca
ggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtgcccaccttt
ggcaagaagaagggccccaatgccaactcttaagtcttttgtaattctggctttctctaa
taaaaaagccacttagttca-gnntcynnnnnn

Data files

None.

Notes

trimseq will remove from a terminal region:

Rather than removing individual characters, it removes an entire segment, using a threshold percentage of unwanted characters in a window of a specified size which is moved along the sequence from the ends. The program stops trimming when the percentage of unwanted characters in the moving window drops below the specified threshold percentage.

Thus if the window size is set to 1 and the percentage threshold is 100, no further poor quality regions will be removed. If the window size is set to 5 and the percentage threshold is 40 then the sequence AAGCTNNNNATT will be trimmed to AAGCT, while AAGCTNATT or AAGCTNNNNATTT will not be trimmed as less than 40% of the last 5 characters are N's.

After trimming these poor quality regions, it will again then trim off any dangling gap characters from the ends.

References

None.

Warnings

None.

Diagnostic Error Messages

None.

Exit status

It always exits with status 0.

Known bugs

None noted.

See also

Program name Description
aligncopy Reads and writes alignments
aligncopypair Reads and writes pairs from alignments
biosed Replace or delete sequence sections
codcopy Copy and reformat a codon usage table
cutseq Removes a section from a sequence
degapseq Removes non-alphabetic (e.g. gap) characters from sequences
descseq Alter the name or description of a sequence
entret Retrieves sequence entries from flatfile databases and files
extractalign Extract regions from a sequence alignment
extractfeat Extract features from sequence(s)
extractseq Extract regions from a sequence
featcopy Reads and writes a feature table
featreport Reads and writes a feature table
listor Write a list file of the logical OR of two sets of sequences
makenucseq Create random nucleotide sequences
makeprotseq Create random protein sequences
maskambignuc Masks all ambiguity characters in nucleotide sequences with N
maskambigprot Masks all ambiguity characters in protein sequences with X
maskfeat Write a sequence with masked features
maskseq Write a sequence with masked regions
newseq Create a sequence file from a typed-in sequence
nohtml Remove mark-up (e.g. HTML tags) from an ASCII text file
noreturn Remove carriage return from ASCII files
nospace Remove all whitespace from an ASCII text file
notab Replace tabs with spaces in an ASCII text file
notseq Write to file a subset of an input stream of sequences
nthseq Write to file a single sequence from an input stream of sequences
nthseqset Reads and writes (returns) one set of sequences from many
pasteseq Insert one sequence into another
revseq Reverse and complement a nucleotide sequence
seqret Reads and writes (returns) sequences
seqretsetall Reads and writes (returns) many sets of sequences
seqretsplit Reads sequences and writes them to individual files
sizeseq Sort sequences by size
skipredundant Remove redundant sequences from an input set
skipseq Reads and writes (returns) sequences, skipping first few
splitsource Split sequence(s) into original source sequences
splitter Split sequence(s) into smaller sequences
trimest Remove poly-A tails from nucleotide sequences
trimspace Remove extra whitespace from an ASCII text file
union Concatenate multiple sequences into a single sequence
vectorstrip Removes vectors from the ends of nucleotide sequence(s)
yank Add a sequence reference (a full USA) to a list file

Author(s)

Gary Williams (gwilliam © rfcgr.mrc.ac.uk)
MRC Rosalind Franklin Centre for Genomics Research Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SB, UK

History

Target users

This program is intended to be used by everyone and everything, from naive users to embedded scripts.

Comments

None