|
|
union |
Please help by correcting and extending the Wiki pages.
union reads in several sequences, concatenates them and writes them out as a single sequence. The input is typically a list file containing references to multiple sequences or subsequences (regions of a sequence). Optionally, feature information will be used.
The output can have source features generated which document composite sequences in the EMBL/GenBank feature table. The -findoverlap optin checks for overlaps between adjacent joined regions and reports them in the overlap file.
The file 'cds.list' contains a list of the regions making up the coding sequence of 'embl:x65923':
% union Concatenate multiple sequences into a single sequence Input (gapped) sequence(s): @cds.list output sequence [x65921.fasta]: |
Go to the input files for this example
Go to the output files for this example
Concatenate multiple sequences into a single sequence
Version: EMBOSS:6.5.0.0
Standard (Mandatory) qualifiers:
[-sequence] seqall (Gapped) sequence(s) filename and optional
format, or reference (input USA)
[-outseq] seqout [
|
| Qualifier | Type | Description | Allowed values | Default |
|---|---|---|---|---|
| Standard (Mandatory) qualifiers | ||||
| [-sequence] (Parameter 1) |
seqall | (Gapped) sequence(s) filename and optional format, or reference (input USA) | Readable sequence(s) | Required |
| [-outseq] (Parameter 2) |
seqout | Sequence filename and optional format (output USA) | Writeable sequence | <*>.format |
| Additional (Optional) qualifiers | ||||
| -overlapfile | outfile | Sequence overlaps output file (optional) | Output file | <*>.union |
| Advanced (Unprompted) qualifiers | ||||
| -feature | boolean | Use feature information | Boolean value Yes/No | No |
| -source | boolean | Create source features | Boolean value Yes/No | No |
| -findoverlap | boolean | Look for overlaps when joining | Boolean value Yes/No | No |
| Associated qualifiers | ||||
| "-sequence" associated seqall qualifiers | ||||
| -sbegin1 -sbegin_sequence |
integer | Start of each sequence to be used | Any integer value | 0 |
| -send1 -send_sequence |
integer | End of each sequence to be used | Any integer value | 0 |
| -sreverse1 -sreverse_sequence |
boolean | Reverse (if DNA) | Boolean value Yes/No | N |
| -sask1 -sask_sequence |
boolean | Ask for begin/end/reverse | Boolean value Yes/No | N |
| -snucleotide1 -snucleotide_sequence |
boolean | Sequence is nucleotide | Boolean value Yes/No | N |
| -sprotein1 -sprotein_sequence |
boolean | Sequence is protein | Boolean value Yes/No | N |
| -slower1 -slower_sequence |
boolean | Make lower case | Boolean value Yes/No | N |
| -supper1 -supper_sequence |
boolean | Make upper case | Boolean value Yes/No | N |
| -scircular1 -scircular_sequence |
boolean | Sequence is circular | Boolean value Yes/No | N |
| -sformat1 -sformat_sequence |
string | Input sequence format | Any string | |
| -iquery1 -iquery_sequence |
string | Input query fields or ID list | Any string | |
| -ioffset1 -ioffset_sequence |
integer | Input start position offset | Any integer value | 0 |
| -sdbname1 -sdbname_sequence |
string | Database name | Any string | |
| -sid1 -sid_sequence |
string | Entryname | Any string | |
| -ufo1 -ufo_sequence |
string | UFO features | Any string | |
| -fformat1 -fformat_sequence |
string | Features format | Any string | |
| -fopenfile1 -fopenfile_sequence |
string | Features file name | Any string | |
| "-outseq" associated seqout qualifiers | ||||
| -osformat2 -osformat_outseq |
string | Output seq format | Any string | |
| -osextension2 -osextension_outseq |
string | File name extension | Any string | |
| -osname2 -osname_outseq |
string | Base file name | Any string | |
| -osdirectory2 -osdirectory_outseq |
string | Output directory | Any string | |
| -osdbname2 -osdbname_outseq |
string | Database name to add | Any string | |
| -ossingle2 -ossingle_outseq |
boolean | Separate file for each entry | Boolean value Yes/No | N |
| -oufo2 -oufo_outseq |
string | UFO features | Any string | |
| -offormat2 -offormat_outseq |
string | Features format | Any string | |
| -ofname2 -ofname_outseq |
string | Features file name | Any string | |
| -ofdirectory2 -ofdirectory_outseq |
string | Output directory | Any string | |
| "-overlapfile" associated outfile qualifiers | ||||
| -odirectory | string | Output directory | Any string | |
| General qualifiers | ||||
| -auto | boolean | Turn off prompts | Boolean value Yes/No | N |
| -stdout | boolean | Write first file to standard output | Boolean value Yes/No | N |
| -filter | boolean | Read first file from standard input, write first file to standard output | Boolean value Yes/No | N |
| -options | boolean | Prompt for standard and additional values | Boolean value Yes/No | N |
| -debug | boolean | Write debug output to program.dbg | Boolean value Yes/No | N |
| -verbose | boolean | Report some/full command line options | Boolean value Yes/No | Y |
| -help | boolean | Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose | Boolean value Yes/No | N |
| -warning | boolean | Report warnings | Boolean value Yes/No | Y |
| -error | boolean | Report errors | Boolean value Yes/No | Y |
| -fatal | boolean | Report fatal errors | Boolean value Yes/No | Y |
| -die | boolean | Report dying program messages | Boolean value Yes/No | Y |
| -version | boolean | Report version number and exit | Boolean value Yes/No | N |
tembl-id:X65921[782:856] tembl-id:X65921[951:1095] tembl-id:X65921[1557:1612] tembl-id:X65921[1787:1912] |
You may find the program yank useful for creating List files.
>X65921 X65921.1 H.sapiens fau 1 gene atgcagctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacg gtcgcccagatcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtc gtgctcctggcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggag gccctgactaccctggaagtagcaggccgcatgcttggaggtaaagtccatggttccctg gcccgtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaag aagaagacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtg cccacctttggcaagaagaagggccccaatgccaactcttaa |
The result is a normal sequence file containing a single sequence resulting from the concatenation of the input sequences.
union is most useful when the input sequences are specified in a "list file". A list file contain references to any number of sequences which are retrieved from some other file or database. Each sequence reference is a Uniform Sequence Address (USA) which can include the specification of sub-regions of the sequence, eg. em:x65923[20:55]). Specifying several such subregions in a sequence or sequences allows you to enter disjoint sequences to be joined.
| Program name | Description |
|---|---|
| aligncopy | Read and write alignments |
| aligncopypair | Read and write pairs from alignments |
| biosed | Replace or delete sequence sections |
| codcopy | Copy and reformat a codon usage table |
| cutseq | Remove a section from a sequence |
| degapseq | Remove non-alphabetic (e.g. gap) characters from sequences |
| descseq | Alter the name or description of a sequence |
| entret | Retrieve sequence entries from flatfile databases and files |
| extractalign | Extract regions from a sequence alignment |
| extractfeat | Extract features from sequence(s) |
| extractseq | Extract regions from a sequence |
| featcopy | Read and write a feature table |
| featmerge | Merge two overlapping feature tables |
| featreport | Read and write a feature table |
| feattext | Return a feature table original text |
| listor | Write a list file of the logical OR of two sets of sequences |
| makenucseq | Create random nucleotide sequences |
| makeprotseq | Create random protein sequences |
| maskambignuc | Mask all ambiguity characters in nucleotide sequences with N |
| maskambigprot | Mask all ambiguity characters in protein sequences with X |
| maskfeat | Write a sequence with masked features |
| maskseq | Write a sequence with masked regions |
| newseq | Create a sequence file from a typed-in sequence |
| nohtml | Remove mark-up (e.g. HTML tags) from an ASCII text file |
| noreturn | Remove carriage return from ASCII files |
| nospace | Remove whitespace from an ASCII text file |
| notab | Replace tabs with spaces in an ASCII text file |
| notseq | Write to file a subset of an input stream of sequences |
| nthseq | Write to file a single sequence from an input stream of sequences |
| nthseqset | Read and write (return) one set of sequences from many |
| pasteseq | Insert one sequence into another |
| revseq | Reverse and complement a nucleotide sequence |
| seqcount | Read and count sequences |
| seqret | Read and write (return) sequences |
| seqretsetall | Read and write (return) many sets of sequences |
| seqretsplit | Read sequences and write them to individual files |
| sizeseq | Sort sequences by size |
| skipredundant | Remove redundant sequences from an input set |
| skipseq | Read and write (return) sequences, skipping first few |
| splitsource | Split sequence(s) into original source sequences |
| splitter | Split sequence(s) into smaller sequences |
| trimest | Remove poly-A tails from nucleotide sequences |
| trimseq | Remove unwanted characters from start and end of sequence(s) |
| trimspace | Remove extra whitespace from an ASCII text file |
| vectorstrip | Remove vectors from the ends of nucleotide sequence(s) |
| yank | Add a sequence reference (a full USA) to a list file |
You may find the program yank useful for creating List files.
Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author.