|
|
cutseq |
It removes the sequence from the specified start to the end positions (inclusive) and returns the rest of the sequence in the output file.
To remove bases 10 to 12 from a database entry and write to the new sequence file 'gatta2.seq':
% cutseq tembl:paamir gatta2.seq -from=10 -to=12 Removes a specified section from a sequence. |
Go to the input files for this example
Go to the output files for this example
Example 2
To remove the first 20 bases from 'tembl:paamir' and write it to 'jsh.seq':
% cutseq tembl:paamir -from=1 -to=20 -out=jsh.seq Removes a specified section from a sequence. |
Go to the output files for this example
Example 3
If the default start and end positions are accepted, then all of the sequence is removed!
% cutseq tembl:paamir starta.seq -sbeg=-1000 -send=1290 Removes a specified section from a sequence. Start of region to delete [1168]: End of region to delete [1290]: |
Go to the output files for this example
Standard (Mandatory) qualifiers:
[-sequence] sequence (Gapped) sequence filename and optional
format, or reference (input USA)
-from integer [Start of sequence (0)] This is the start
position (inclusive) of the section of the
sequence that you wish to remove. (Any
integer value)
-to integer [End of sequence (0)] This is the end
position (inclusive) of the section of the
sequence that you wish to remove. (Any
integer value)
[-outseq] seqout [
|
| Standard (Mandatory) qualifiers | Allowed values | Default | |
|---|---|---|---|
| [-sequence] (Parameter 1) |
(Gapped) sequence filename and optional format, or reference (input USA) | Readable sequence | Required |
| -from | This is the start position (inclusive) of the section of the sequence that you wish to remove. | Any integer value | Start of sequence (0) |
| -to | This is the end position (inclusive) of the section of the sequence that you wish to remove. | Any integer value | End of sequence (0) |
| [-outseq] (Parameter 2) |
Sequence filename and optional format (output USA) | Writeable sequence | |
| Additional (Optional) qualifiers | Allowed values | Default | |
| (none) | |||
| Advanced (Unprompted) qualifiers | Allowed values | Default | |
| (none) | |||
ID PAAMIR standard; DNA; PRO; 2167 BP.
XX
AC X13776; M43175;
XX
SV X13776.1
XX
DT 19-APR-1989 (Rel. 19, Created)
DT 17-FEB-1997 (Rel. 50, Last updated, Version 22)
XX
DE Pseudomonas aeruginosa amiC and amiR gene for aliphatic amidase regulation
XX
KW aliphatic amidase regulator; amiC gene; amiR gene.
XX
OS Pseudomonas aeruginosa
OC Bacteria; Proteobacteria; gamma subdivision; Pseudomonadaceae; Pseudomonas.
XX
RN [1]
RP 1167-2167
RA Rice P.M.;
RT ;
RL Submitted (16-DEC-1988) to the EMBL/GenBank/DDBJ databases.
RL Rice P.M., EMBL, Postfach 10-2209, Meyerhofstrasse 1, 6900 Heidelberg, FRG.
XX
RN [2]
RP 1167-2167
RX MEDLINE; 89211409.
RA Lowe N., Rice P.M., Drew R.E.;
RT "Nucleotide sequence of the aliphatic amidase regulator gene of Pseudomonas
RT aeruginosa";
RL FEBS Lett. 246:39-43(1989).
XX
RN [3]
RP 1-1292
RX MEDLINE; 91317707.
RA Wilson S., Drew R.;
RT "Cloning and DNA seqence of amiC, a new gene regulating expression of the
RT Pseudomonas aeruginosa aliphatic amidase, and purification of the amiC
RT product.";
RL J. Bacteriol. 173:4914-4921(1991).
XX
RN [4]
RP 1-2167
RA Rice P.M.;
RT ;
RL Submitted (04-SEP-1991) to the EMBL/GenBank/DDBJ databases.
RL Rice P.M., EMBL, Postfach 10-2209, Meyerhofstrasse 1, 6900 Heidelberg, FRG.
XX
DR SWISS-PROT; P10932; AMIR_PSEAE.
DR SWISS-PROT; P27017; AMIC_PSEAE.
DR SWISS-PROT; Q51417; AMIS_PSEAE.
[Part of this file has been deleted for brevity]
FT phenotype"
FT /replace=""
FT /gene="amiC"
FT misc_feature 1
FT /note="last base of an XhoI site"
FT misc_feature 648..653
FT /note="end of 658bp XhoI fragment, deletion in pSW3 causes
FT constitutive expression of amiE"
FT conflict 1281
FT /replace="g"
FT /citation=[3]
XX
SQ Sequence 2167 BP; 363 A; 712 C; 730 G; 362 T; 0 other;
ggtaccgctg gccgagcatc tgctcgatca ccaccagccg ggcgacggga actgcacgat 60
ctacctggcg agcctggagc acgagcgggt tcgcttcgta cggcgctgag cgacagtcac 120
aggagaggaa acggatggga tcgcaccagg agcggccgct gatcggcctg ctgttctccg 180
aaaccggcgt caccgccgat atcgagcgct cgcacgcgta tggcgcattg ctcgcggtcg 240
agcaactgaa ccgcgagggc ggcgtcggcg gtcgcccgat cgaaacgctg tcccaggacc 300
ccggcggcga cccggaccgc tatcggctgt gcgccgagga cttcattcgc aaccgggggg 360
tacggttcct cgtgggctgc tacatgtcgc acacgcgcaa ggcggtgatg ccggtggtcg 420
agcgcgccga cgcgctgctc tgctacccga ccccctacga gggcttcgag tattcgccga 480
acatcgtcta cggcggtccg gcgccgaacc agaacagtgc gccgctggcg gcgtacctga 540
ttcgccacta cggcgagcgg gtggtgttca tcggctcgga ctacatctat ccgcgggaaa 600
gcaaccatgt gatgcgccac ctgtatcgcc agcacggcgg cacggtgctc gaggaaatct 660
acattccgct gtatccctcc gacgacgact tgcagcgcgc cgtcgagcgc atctaccagg 720
cgcgcgccga cgtggtcttc tccaccgtgg tgggcaccgg caccgccgag ctgtatcgcg 780
ccatcgcccg tcgctacggc gacggcaggc ggccgccgat cgccagcctg accaccagcg 840
aggcggaggt ggcgaagatg gagagtgacg tggcagaggg gcaggtggtg gtcgcgcctt 900
acttctccag catcgatacg cccgccagcc gggccttcgt ccaggcctgc catggtttct 960
tcccggagaa cgcgaccatc accgcctggg ccgaggcggc ctactggcag accttgttgc 1020
tcggccgcgc cgcgcaggcc gcaggcaact ggcgggtgga agacgtgcag cggcacctgt 1080
acgacatcga catcgacgcg ccacaggggc cggtccgggt ggagcgccag aacaaccaca 1140
gccgcctgtc ttcgcgcatc gcggaaatcg atgcgcgcgg cgtgttccag gtccgctggc 1200
agtcgcccga accgattcgc cccgaccctt atgtcgtcgt gcataacctc gacgactggt 1260
ccgccagcat gggcggggga ccgctcccat gagcgccaac tcgctgctcg gcagcctgcg 1320
cgagttgcag gtgctggtcc tcaacccgcc gggggaggtc agcgacgccc tggtcttgca 1380
gctgatccgc atcggttgtt cggtgcgcca gtgctggccg ccgccggaag ccttcgacgt 1440
gccggtggac gtggtcttca ccagcatttt ccagaatggc caccacgacg agatcgctgc 1500
gctgctcgcc gccgggactc cgcgcactac cctggtggcg ctggtggagt acgaaagccc 1560
cgcggtgctc tcgcagatca tcgagctgga gtgccacggc gtgatcaccc agccgctcga 1620
tgcccaccgg gtgctgcctg tgctggtatc ggcgcggcgc atcagcgagg aaatggcgaa 1680
gctgaagcag aagaccgagc agctccagga ccgcatcgcc ggccaggccc ggatcaacca 1740
ggccaaggtg ttgctgatgc agcgccatgg ctgggacgag cgcgaggcgc accagcacct 1800
gtcgcgggaa gcgatgaagc ggcgcgagcc gatcctgaag atcgctcagg agttgctggg 1860
aaacgagccg tccgcctgag cgatccgggc cgaccagaac aataacaaga ggggtatcgt 1920
catcatgctg ggactggttc tgctgtacgt tggcgcggtg ctgtttctca atgccgtctg 1980
gttgctgggc aagatcagcg gtcgggaggt ggcggtgatc aacttcctgg tcggcgtgct 2040
gagcgcctgc gtcgcgttct acctgatctt ttccgcagca gccgggcagg gctcgctgaa 2100
ggccggagcg ctgaccctgc tattcgcttt tacctatctg tgggtggccg ccaaccagtt 2160
cctcgag 2167
//
|
>PAAMIR X13776.1 Pseudomonas aeruginosa amiC and amiR gene for aliphatic amidase regulation ggtaccgctcgagcatctgctcgatcaccaccagccgggcgacgggaactgcacgatcta cctggcgagcctggagcacgagcgggttcgcttcgtacggcgctgagcgacagtcacagg agaggaaacggatgggatcgcaccaggagcggccgctgatcggcctgctgttctccgaaa ccggcgtcaccgccgatatcgagcgctcgcacgcgtatggcgcattgctcgcggtcgagc aactgaaccgcgagggcggcgtcggcggtcgcccgatcgaaacgctgtcccaggaccccg gcggcgacccggaccgctatcggctgtgcgccgaggacttcattcgcaaccggggggtac ggttcctcgtgggctgctacatgtcgcacacgcgcaaggcggtgatgccggtggtcgagc gcgccgacgcgctgctctgctacccgaccccctacgagggcttcgagtattcgccgaaca tcgtctacggcggtccggcgccgaaccagaacagtgcgccgctggcggcgtacctgattc gccactacggcgagcgggtggtgttcatcggctcggactacatctatccgcgggaaagca accatgtgatgcgccacctgtatcgccagcacggcggcacggtgctcgaggaaatctaca ttccgctgtatccctccgacgacgacttgcagcgcgccgtcgagcgcatctaccaggcgc gcgccgacgtggtcttctccaccgtggtgggcaccggcaccgccgagctgtatcgcgcca tcgcccgtcgctacggcgacggcaggcggccgccgatcgccagcctgaccaccagcgagg cggaggtggcgaagatggagagtgacgtggcagaggggcaggtggtggtcgcgccttact tctccagcatcgatacgcccgccagccgggccttcgtccaggcctgccatggtttcttcc cggagaacgcgaccatcaccgcctgggccgaggcggcctactggcagaccttgttgctcg gccgcgccgcgcaggccgcaggcaactggcgggtggaagacgtgcagcggcacctgtacg acatcgacatcgacgcgccacaggggccggtccgggtggagcgccagaacaaccacagcc gcctgtcttcgcgcatcgcggaaatcgatgcgcgcggcgtgttccaggtccgctggcagt cgcccgaaccgattcgccccgacccttatgtcgtcgtgcataacctcgacgactggtccg ccagcatgggcgggggaccgctcccatgagcgccaactcgctgctcggcagcctgcgcga gttgcaggtgctggtcctcaacccgccgggggaggtcagcgacgccctggtcttgcagct gatccgcatcggttgttcggtgcgccagtgctggccgccgccggaagccttcgacgtgcc ggtggacgtggtcttcaccagcattttccagaatggccaccacgacgagatcgctgcgct gctcgccgccgggactccgcgcactaccctggtggcgctggtggagtacgaaagccccgc ggtgctctcgcagatcatcgagctggagtgccacggcgtgatcacccagccgctcgatgc ccaccgggtgctgcctgtgctggtatcggcgcggcgcatcagcgaggaaatggcgaagct gaagcagaagaccgagcagctccaggaccgcatcgccggccaggcccggatcaaccaggc caaggtgttgctgatgcagcgccatggctgggacgagcgcgaggcgcaccagcacctgtc gcgggaagcgatgaagcggcgcgagccgatcctgaagatcgctcaggagttgctgggaaa cgagccgtccgcctgagcgatccgggccgaccagaacaataacaagaggggtatcgtcat catgctgggactggttctgctgtacgttggcgcggtgctgtttctcaatgccgtctggtt gctgggcaagatcagcggtcgggaggtggcggtgatcaacttcctggtcggcgtgctgag cgcctgcgtcgcgttctacctgatcttttccgcagcagccgggcagggctcgctgaaggc cggagcgctgaccctgctattcgcttttacctatctgtgggtggccgccaaccagttcct cgag |
>PAAMIR X13776.1 Pseudomonas aeruginosa amiC and amiR gene for aliphatic amidase regulation tgctcgatcaccaccagccgggcgacgggaactgcacgatctacctggcgagcctggagc acgagcgggttcgcttcgtacggcgctgagcgacagtcacaggagaggaaacggatggga tcgcaccaggagcggccgctgatcggcctgctgttctccgaaaccggcgtcaccgccgat atcgagcgctcgcacgcgtatggcgcattgctcgcggtcgagcaactgaaccgcgagggc ggcgtcggcggtcgcccgatcgaaacgctgtcccaggaccccggcggcgacccggaccgc tatcggctgtgcgccgaggacttcattcgcaaccggggggtacggttcctcgtgggctgc tacatgtcgcacacgcgcaaggcggtgatgccggtggtcgagcgcgccgacgcgctgctc tgctacccgaccccctacgagggcttcgagtattcgccgaacatcgtctacggcggtccg gcgccgaaccagaacagtgcgccgctggcggcgtacctgattcgccactacggcgagcgg gtggtgttcatcggctcggactacatctatccgcgggaaagcaaccatgtgatgcgccac ctgtatcgccagcacggcggcacggtgctcgaggaaatctacattccgctgtatccctcc gacgacgacttgcagcgcgccgtcgagcgcatctaccaggcgcgcgccgacgtggtcttc tccaccgtggtgggcaccggcaccgccgagctgtatcgcgccatcgcccgtcgctacggc gacggcaggcggccgccgatcgccagcctgaccaccagcgaggcggaggtggcgaagatg gagagtgacgtggcagaggggcaggtggtggtcgcgccttacttctccagcatcgatacg cccgccagccgggccttcgtccaggcctgccatggtttcttcccggagaacgcgaccatc accgcctgggccgaggcggcctactggcagaccttgttgctcggccgcgccgcgcaggcc gcaggcaactggcgggtggaagacgtgcagcggcacctgtacgacatcgacatcgacgcg ccacaggggccggtccgggtggagcgccagaacaaccacagccgcctgtcttcgcgcatc gcggaaatcgatgcgcgcggcgtgttccaggtccgctggcagtcgcccgaaccgattcgc cccgacccttatgtcgtcgtgcataacctcgacgactggtccgccagcatgggcggggga ccgctcccatgagcgccaactcgctgctcggcagcctgcgcgagttgcaggtgctggtcc tcaacccgccgggggaggtcagcgacgccctggtcttgcagctgatccgcatcggttgtt cggtgcgccagtgctggccgccgccggaagccttcgacgtgccggtggacgtggtcttca ccagcattttccagaatggccaccacgacgagatcgctgcgctgctcgccgccgggactc cgcgcactaccctggtggcgctggtggagtacgaaagccccgcggtgctctcgcagatca tcgagctggagtgccacggcgtgatcacccagccgctcgatgcccaccgggtgctgcctg tgctggtatcggcgcggcgcatcagcgaggaaatggcgaagctgaagcagaagaccgagc agctccaggaccgcatcgccggccaggcccggatcaaccaggccaaggtgttgctgatgc agcgccatggctgggacgagcgcgaggcgcaccagcacctgtcgcgggaagcgatgaagc ggcgcgagccgatcctgaagatcgctcaggagttgctgggaaacgagccgtccgcctgag cgatccgggccgaccagaacaataacaagaggggtatcgtcatcatgctgggactggttc tgctgtacgttggcgcggtgctgtttctcaatgccgtctggttgctgggcaagatcagcg gtcgggaggtggcggtgatcaacttcctggtcggcgtgctgagcgcctgcgtcgcgttct acctgatcttttccgcagcagccgggcagggctcgctgaaggccggagcgctgaccctgc tattcgcttttacctatctgtgggtggccgccaaccagttcctcgag |
>PAAMIR X13776.1 Pseudomonas aeruginosa amiC and amiR gene for aliphatic amidase regulation |
| Program name | Description |
|---|---|
| biosed | Replace or delete sequence sections |
| codcopy | Reads and writes a codon usage table |
| degapseq | Removes gap characters from sequences |
| descseq | Alter the name or description of a sequence |
| entret | Reads and writes (returns) flatfile entries |
| extractfeat | Extract features from a sequence |
| extractseq | Extract regions from a sequence |
| listor | Write a list file of the logical OR of two sets of sequences |
| makenucseq | Creates random nucleotide sequences |
| makeprotseq | Creates random protein sequences |
| maskfeat | Mask off features of a sequence |
| maskseq | Mask off regions of a sequence |
| newseq | Type in a short new sequence |
| noreturn | Removes carriage return from ASCII files |
| notseq | Exclude a set of sequences and write out the remaining ones |
| nthseq | Writes one sequence from a multiple set of sequences |
| pasteseq | Insert one sequence into another |
| revseq | Reverse and complement a sequence |
| seqret | Reads and writes (returns) sequences |
| seqretsplit | Reads and writes (returns) sequences in individual files |
| skipseq | Reads and writes (returns) sequences, skipping first few |
| splitter | Split a sequence into (overlapping) smaller sequences |
| trimest | Trim poly-A tails off EST sequences |
| trimseq | Trim ambiguous bits off the ends of sequences |
| union | Reads sequence fragments and builds one sequence |
| vectorstrip | Strips out DNA between a pair of vector sequences |
| yank | Reads a sequence range, appends the full USA to a list file |