|
|
listor |
When comparing sequences to see if they are the same between two sets of sequences, no use is made of the ID name or accession number of the sequences. Only the sequences themselves are compared. The comparison of the sequences is case-independent.
The logical union is an OR operation by default. Other available operations are: AND, XOR and NOT.
The (default) logical OR of the two sets of sequences is simply the result of merging the two sets of sequences, (without listing any shared sequences twice).
A logical AND simply lists those sequences that occur in both sets of sequences.
A logical XOR lists those sequences that ONLY occur in the first set or only occur in the second set - sequences occuring in both sets are ignored (the opposite of an AND).
A logical NOT lists all those sequences in the first set except for those that also occur in the second set.
Write the logical OR of two lists:
% listor ../data/file2 Write a list file of the logical OR of two sets of sequences List of USAs output file [file1.list]: |
Go to the input files for this example
Go to the output files for this example
Example 2
Write the logical AND of two lists:
% listor ../data/file2 -operator and Write a list file of the logical OR of two sets of sequences List of USAs output file [file1.list]: |
Go to the output files for this example
Example 3
Write the logical XOR of two lists:
% listor ../data/file2 -operator xor Write a list file of the logical OR of two sets of sequences List of USAs output file [file1.list]: |
Go to the output files for this example
Example 4
Write the logical NOT of two lists:
% listor ../data/file2 -operator not Write a list file of the logical OR of two sets of sequences List of USAs output file [file1.list]: |
Go to the output files for this example
Standard (Mandatory) qualifiers:
[-firstsequences] seqset Sequence set filename and optional format,
or reference (input USA)
[-secondsequences] seqset Sequence set filename and optional format,
or reference (input USA)
[-outfile] outfile [*.listor] The list of sequence names will
be written to this list file
Additional (Optional) qualifiers:
-operator menu [OR] The following logical operators combine
the sequences in the following ways:
OR - gives all that occur in one set or the
other
AND - gives only those which occur in both
sets
XOR - gives those which only occur in one
set or the other, but not in both
NOT - gives those which occur in the first
set except for those that also occur in the
second (Values: O (OR - merger of both
sets); A (AND - only those in both sets); X
(XOR - only those not in both sets); N (NOT
- those of the first set that are not in the
second))
Advanced (Unprompted) qualifiers: (none)
Associated qualifiers:
"-firstsequences" associated qualifiers
-sbegin1 integer Start of each sequence to be used
-send1 integer End of each sequence to be used
-sreverse1 boolean Reverse (if DNA)
-sask1 boolean Ask for begin/end/reverse
-snucleotide1 boolean Sequence is nucleotide
-sprotein1 boolean Sequence is protein
-slower1 boolean Make lower case
-supper1 boolean Make upper case
-sformat1 string Input sequence format
-sdbname1 string Database name
-sid1 string Entryname
-ufo1 string UFO features
-fformat1 string Features format
-fopenfile1 string Features file name
"-secondsequences" associated qualifiers
-sbegin2 integer Start of each sequence to be used
-send2 integer End of each sequence to be used
-sreverse2 boolean Reverse (if DNA)
-sask2 boolean Ask for begin/end/reverse
-snucleotide2 boolean Sequence is nucleotide
-sprotein2 boolean Sequence is protein
-slower2 boolean Make lower case
-supper2 boolean Make upper case
-sformat2 string Input sequence format
-sdbname2 string Database name
-sid2 string Entryname
-ufo2 string UFO features
-fformat2 string Features format
-fopenfile2 string Features file name
"-outfile" associated qualifiers
-odirectory3 string Output directory
General qualifiers:
-auto boolean Turn off prompts
-stdout boolean Write standard output
-filter boolean Read standard input, write standard output
-options boolean Prompt for standard and additional values
-debug boolean Write debug output to program.dbg
-verbose boolean Report some/full command line options
-help boolean Report command line options. More
information on associated and general
qualifiers can be found with -help -verbose
-warning boolean Report warnings
-error boolean Report errors
-fatal boolean Report fatal errors
-die boolean Report dying program messages
|
| Standard (Mandatory) qualifiers | Allowed values | Default | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| [-firstsequences] (Parameter 1) |
Sequence set filename and optional format, or reference (input USA) | Readable set of sequences | Required | ||||||||
| [-secondsequences] (Parameter 2) |
Sequence set filename and optional format, or reference (input USA) | Readable set of sequences | Required | ||||||||
| [-outfile] (Parameter 3) |
The list of sequence names will be written to this list file | Output file | |||||||||
| Additional (Optional) qualifiers | Allowed values | Default | |||||||||
| -operator | The following logical operators combine the sequences in the following ways: OR - gives all that occur in one set or the other AND - gives only those which occur in both sets XOR - gives those which only occur in one set or the other, but not in both NOT - gives those which occur in the first set except for those that also occur in the second |
|
OR | ||||||||
| Advanced (Unprompted) qualifiers | Allowed values | Default | |||||||||
| (none) | |||||||||||
>one tagctagcg >two tagctagcggctacgt >three tagctattttatgctacgtcagtgac |
>two tagctagcggctacgt >three tagctattttatgctacgtcagtgac >four gcgcggcgcgcgtgcgtcgttgctggggccc |
The order that the USAs are written out is not necessarily the same as the order of either of the input sets of sequences.
The results of the four types of logical union follows. Note that the duplicated sequences in these two files have been given the same name. This is not necessary for the operation of listor as it compares the sequences themselves, not the ID names of the sequences.
fasta::../../data/file1:one fasta::../../data/file1:two fasta::../../data/file1:three fasta::../../data/file2:four |
fasta::../../data/file1:two fasta::../../data/file1:three |
fasta::../../data/file1:one fasta::../../data/file2:four |
fasta::../../data/file1:one |
| Program name | Description |
|---|---|
| biosed | Replace or delete sequence sections |
| codcopy | Reads and writes a codon usage table |
| cutseq | Removes a specified section from a sequence |
| degapseq | Removes gap characters from sequences |
| descseq | Alter the name or description of a sequence |
| entret | Reads and writes (returns) flatfile entries |
| extractfeat | Extract features from a sequence |
| extractseq | Extract regions from a sequence |
| makenucseq | Creates random nucleotide sequences |
| makeprotseq | Creates random protein sequences |
| maskfeat | Mask off features of a sequence |
| maskseq | Mask off regions of a sequence |
| newseq | Type in a short new sequence |
| noreturn | Removes carriage return from ASCII files |
| notseq | Exclude a set of sequences and write out the remaining ones |
| nthseq | Writes one sequence from a multiple set of sequences |
| pasteseq | Insert one sequence into another |
| revseq | Reverse and complement a sequence |
| seqret | Reads and writes (returns) sequences |
| seqretsplit | Reads and writes (returns) sequences in individual files |
| skipseq | Reads and writes (returns) sequences, skipping first few |
| splitter | Split a sequence into (overlapping) smaller sequences |
| trimest | Trim poly-A tails off EST sequences |
| trimseq | Trim ambiguous bits off the ends of sequences |
| union | Reads sequence fragments and builds one sequence |
| vectorstrip | Strips out DNA between a pair of vector sequences |
| yank | Reads a sequence range, appends the full USA to a list file |