|
|
stssearch |
stssearchs reads in one or more sequences to be searched. For each pair of primers, it looks for matches between a the primers and the query sequence in either orientation.
Any matches found will be reported. Only one primer need match for it to be reported..
% stssearch Search a DNA database for matches with a set of STS primers Input nucleotide sequence(s): tembl:eclac* Primer pairs file: lac.primers Output file [eclac.stssearch]: |
Go to the input files for this example
Go to the output files for this example
Standard (Mandatory) qualifiers:
[-seqall] seqall Nucleotide sequence(s) filename and optional
format, or reference (input USA)
[-infile] infile Primer pairs file
[-outfile] outfile [*.stssearch] Output file name
Additional (Optional) qualifiers: (none)
Advanced (Unprompted) qualifiers: (none)
Associated qualifiers:
"-seqall" associated qualifiers
-sbegin1 integer Start of each sequence to be used
-send1 integer End of each sequence to be used
-sreverse1 boolean Reverse (if DNA)
-sask1 boolean Ask for begin/end/reverse
-snucleotide1 boolean Sequence is nucleotide
-sprotein1 boolean Sequence is protein
-slower1 boolean Make lower case
-supper1 boolean Make upper case
-sformat1 string Input sequence format
-sdbname1 string Database name
-sid1 string Entryname
-ufo1 string UFO features
-fformat1 string Features format
-fopenfile1 string Features file name
"-outfile" associated qualifiers
-odirectory3 string Output directory
General qualifiers:
-auto boolean Turn off prompts
-stdout boolean Write standard output
-filter boolean Read standard input, write standard output
-options boolean Prompt for standard and additional values
-debug boolean Write debug output to program.dbg
-verbose boolean Report some/full command line options
-help boolean Report command line options. More
information on associated and general
qualifiers can be found with -help -verbose
-warning boolean Report warnings
-error boolean Report errors
-fatal boolean Report fatal errors
-die boolean Report dying program messages
|
| Standard (Mandatory) qualifiers | Allowed values | Default | |
|---|---|---|---|
| [-seqall] (Parameter 1) |
Nucleotide sequence(s) filename and optional format, or reference (input USA) | Readable sequence(s) | Required |
| [-infile] (Parameter 2) |
Primer pairs file | Input file | Required |
| [-outfile] (Parameter 3) |
Output file name | Output file | |
| Additional (Optional) qualifiers | Allowed values | Default | |
| (none) | |||
| Advanced (Unprompted) qualifiers | Allowed values | Default | |
| (none) | |||
PrimA ACCAGACACCCATCAACAG TATTTATGCCAGCCAGCCAG PrimB CGAAAGAATAAGAGCAGGCAAG GTAAGAGAAATAGACAGGCGG PrimC CGTCAGTATCCCCGTTTACAG TATCGCCAAAATCACCGCC PrimD AATACGCAAACCGCCTCTCC TTATCCGCTCACAATTCCACAC PrimE AATACGCAAACCGCCTCTCC CACAACCCGCTCACAATTCCA |
The primers file consists of three columns separated by tabs or spaces.
The first column is the name of the primer pair.
The second column is the sequence of the first primer.
The third column is the sequence of the second primer.
ECLAC: PrimA PrimerA matched at 532 ECLAC: (rev) PrimA PrimerB matched at 689 ECLAC: PrimB PrimerA matched at 5743 ECLAC: (rev) PrimB PrimerB matched at 5942 ECLAC: PrimC PrimerA matched at 2954 ECLAC: (rev) PrimC PrimerB matched at 3069 ECLAC: PrimD PrimerA matched at 1074 ECLAC: (rev) PrimD PrimerB matched at 1261 ECLAC: PrimE PrimerA matched at 1074 ECLACA: PrimB PrimerA matched at 98 ECLACA: (rev) PrimB PrimerB matched at 297 ECLACI: PrimA PrimerA matched at 484 ECLACI: (rev) PrimA PrimerB matched at 641 ECLACI: PrimD PrimerA matched at 1026 ECLACI: PrimE PrimerA matched at 1026 ECLACY: PrimB PrimerA matched at 1439 ECLACZ: PrimC PrimerA matched at 1668 ECLACZ: (rev) PrimC PrimerB matched at 1783 |
The output file consists of one line per match. This consists of:
| Program name | Description |
|---|---|
| eprimer3 | Picks PCR primers and hybridization oligos |
| primersearch | Searches DNA sequences for matches with primer pairs |
If you want something that only reports matches of both primer pairs and can find mismatches, use primersearch.