extractfeat

 

Function

Extract features from a sequence

Description

extractfeat is a simple utility for extracting parts of a sequence that have been annotated as being a specific type of feature. These sub-sequences are writen to the output sequence file.

If the feature is annotated as being in the reverse sense of a nucleic acid sequence, then that feature's sub-sequence is reverse-complemented before being written out.

It is often useful to have some information on the context of the feature. extractfeat allows you to specify a number of bases or residues before and/or after the feature to write out.

If you are interested in extracting the sequence of the region around the start or end of the feature, then this can also be specified.

'joined' features can either be extracted as individual sequences, or as a single concatenated sequence if the '-join' qualifier is used.

Please remember that the output feature sequence is only as good as the annotation. If you rely upon other people's, or other program's annotation of features, then some of these will be incorrect.

Usage

Here is a sample session with extractfeat

To write out the exons of a sequence:


% extractfeat tembl:hsfau1 -type exon stdout 
Extract features from a sequence

>HSFAU1_408_504 [exon] H.sapiens fau 1 gene
cagtgacgtgacacgcagcccacggtctgtactgacgcgccctcgcttcttcctctttct
cgactccatcttcgcggtagctgggaccgccgttcag
>HSFAU1_774_856 [exon] H.sapiens fau 1 gene
tcgccaatatgcagctctttgtccgcgcccaggagctacacaccttcgaggtgaccggcc
aggaaacggtcgcccagatcaag
>HSFAU1_951_1095 [exon] H.sapiens fau 1 gene
gctcatgtagcctcactggagggcattgccccggaagatcaagtcgtgctcctggcaggc
gcgcccctggaggatgaggccactctgggccagtgcggggtggaggccctgactaccctg
gaagtagcaggccgcatgcttggag
>HSFAU1_1557_1612 [exon] H.sapiens fau 1 gene
gtaaagtccatggttccctggcccgtgctggaaaagtgagaggtcagactcctaag
>HSFAU1_1787_1912 [exon] H.sapiens fau 1 gene
gtggccaaacaggagaagaagaagaagaagacaggtcgggctaagcggcggatgcagtac
aaccggcgctttgtcaacgttgtgcccacctttggcaagaagaagggccccaatgccaac
tcttaa

Go to the input files for this example

Example 2

To write out the exons with 10 extra bases at the start and end so that you can inspect the splice sites:


% extractfeat tembl:hsfau1 -type exon -before 10 -after 10 stdout 
Extract features from a sequence

>HSFAU1_408_504 [exon] H.sapiens fau 1 gene
ggtcgctcagcagtgacgtgacacgcagcccacggtctgtactgacgcgccctcgcttct
tcctctttctcgactccatcttcgcggtagctgggaccgccgttcaggtaagaatgg
>HSFAU1_774_856 [exon] H.sapiens fau 1 gene
ctttactcagtcgccaatatgcagctctttgtccgcgcccaggagctacacaccttcgag
gtgaccggccaggaaacggtcgcccagatcaaggtaaggctgc
>HSFAU1_951_1095 [exon] H.sapiens fau 1 gene
ttccctgtaggctcatgtagcctcactggagggcattgccccggaagatcaagtcgtgct
cctggcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggaggccct
gactaccctggaagtagcaggccgcatgcttggaggtgagtgaga
>HSFAU1_1557_1612 [exon] H.sapiens fau 1 gene
cccactacaggtaaagtccatggttccctggcccgtgctggaaaagtgagaggtcagact
cctaaggtgagtgaga
>HSFAU1_1787_1912 [exon] H.sapiens fau 1 gene
ccttctccaggtggccaaacaggagaagaagaagaagaagacaggtcgggctaagcggcg
gatgcagtacaaccggcgctttgtcaacgttgtgcccacctttggcaagaagaagggccc
caatgccaactcttaagtcttttgta

Example 3

To write out the 10 bases around the start of all 'exon' features in the tembl database:


% extractfeat tembl:*  -type exon -before 5 -after -5 stdout 
Extract features from a sequence

>HSFAU1_408_504 [exon] H.sapiens fau 1 gene
ctcagcagtg
>HSFAU1_774_856 [exon] H.sapiens fau 1 gene
ctcagtcgcc
>HSFAU1_951_1095 [exon] H.sapiens fau 1 gene
tgtaggctca
>HSFAU1_1557_1612 [exon] H.sapiens fau 1 gene
tacaggtaaa
>HSFAU1_1787_1912 [exon] H.sapiens fau 1 gene
tccaggtggc
>HSFOS_889_1029 [exon] Human fos proto-oncogene (c-fos), complete cds.
ccacgatgat
>HSFOS_1783_2034 [exon] Human fos proto-oncogene (c-fos), complete cds.
tctaggactt
>HSFOS_2466_2573 [exon] Human fos proto-oncogene (c-fos), complete cds.
tctagttatc
>HSFOS_2688_3329 [exon] Human fos proto-oncogene (c-fos), complete cds.
tacaggagac
>HSTS1_1001_1205 [exon] Homo sapiens gene for thymidylate synthase, exons 1, 2, 3, 4, 5, 6, 7, complete cds.
gcgccatgcc
>HSTS1_2895_2968 [exon] Homo sapiens gene for thymidylate synthase, exons 1, 2, 3, 4, 5, 6, 7, complete cds.
ttcagatgaa
>HSTS1_5396_5570 [exon] Homo sapiens gene for thymidylate synthase, exons 1, 2, 3, 4, 5, 6, 7, complete cds.
tccagggatc
>HSTS1_11843_11944 [exon] Homo sapiens gene for thymidylate synthase, exons 1, 2, 3, 4, 5, 6, 7, complete cds.
tacagattat
>HSTS1_13449_13624 [exon] Homo sapiens gene for thymidylate synthase, exons 1, 2, 3, 4, 5, 6, 7, complete cds.
ctcagatctt
>HSTS1_14133_14204 [exon] Homo sapiens gene for thymidylate synthase, exons 1, 2, 3, 4, 5, 6, 7, complete cds.
tatagccagg
>HSTS1_15613_15750 [exon] Homo sapiens gene for thymidylate synthase, exons 1, 2, 3, 4, 5, 6, 7, complete cds.
tttagcttca
>AB009062_75_503 [exon] Homo sapiens HERG gene, exon 6.
tgcaggtcct
>HSFERG2_50_196 [exon] Human apoferritin H gene exons 2-4
ttcagtctta
>HSFERG2_453_578 [exon] Human apoferritin H gene exons 2-4
ttcagaaacc
>HSFERG2_674_999 [exon] Human apoferritin H gene exons 2-4
tgcagttgtg
>AP000504_13_134 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
ctcactgtga
>AP000504_868_930 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
gataccaaaa
>AP000504_1081_1161 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
cttaccaagc
>AP000504_2752_2875 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
cccacctctc
>AP000504_3425_3584 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
gagacctcgg
>AP000504_3818_4038 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
gttacccttt
>AP000504_7507_7763 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
ccagcccggg
>AP000504_9766_9875 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
ttcaggctgg
>AP000504_10068_10193 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
tccaggcgga
>AP000504_10357_10463 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
ttcaggtacc
>AP000504_11631_11812 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
cacagatctg
>AP000504_13026_13434 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
ctcaggtggt
>AP000504_14850_15164 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
gagggggagt
>AP000504_15284_15383 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
ctaaggtcga
>AP000504_15505_15578 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
ctcaggccgg
>AP000504_15737_15856 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
cctaggactt
>AP000504_16337_16486 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
tctaggcaat
>AP000504_16676_16987 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
tgcaggcact
>AP000504_18955_19059 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
tcccttcaaa
>AP000504_19185_19264 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
cttaccggtt
>AP000504_19402_19442 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
ctcaccaaat
>AP000504_19797_19887 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
ctcacctgtg
>AP000504_20043_20390 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
cctaccatgg
>AP000504_20585_20645 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
cttaccccca
>AP000504_22296_22401 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
atccttgaaa
>AP000504_23826_23936 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
cccagctgac
>AP000504_24719_25381 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
cctaggtaag
>AP000504_26111_26448 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
gctgtagagt
>AP000504_28403_28525 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
ctcacggttt
>AP000504_28617_28671 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
cttacccaag
>AP000504_30215_30266 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
tggccatggg
>AP000504_31238_31363 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
aacaggtctc
>AP000504_31486_31691 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
ctgagtgaaa
>AP000504_33605_33675 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
gttcctcacc
>AP000504_33846_34001 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
ctcacctctg
>AP000504_35893_36156 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
tttacctgcc
>AP000504_36240_36569 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
ctcacctttg
>AP000504_37069_37123 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
cttacctgca
>AP000504_40724_40877 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
ggaagagcag
>AP000504_41897_41953 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
ggcaggatac
>AP000504_42687_42753 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
tgcaggcttc
>AP000504_42999_43085 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
cccaggttac
>AP000504_46996_47081 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
accaggcatt
>AP000504_50596_50669 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
tgcagaggca
>AP000504_50879_51001 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
ctcaggaagg
>AP000504_52110_52224 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
cacagctacc
>AP000504_52348_52449 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
ctcagtgtaa
>AP000504_53426_53489 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
cctaggtgat
>AP000504_53901_53950 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
tacagctgga
>AP000504_54324_54447 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
tgcagggggt
>AP000504_54909_55013 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
accagccacg
>AP000504_55242_55305 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
tctagggggc
>AP000504_55723_55779 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
tgaagatacc
>AP000504_55925_55987 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
cccagggttc
>AP000504_56128_56204 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
cgtaggtatc
>AP000504_56288_56386 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
accagcctca
>AP000504_56484_56530 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
tgcaggggag
>AP000504_56733_57055 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
ctcaggctcg
>AP000504_59988_60040 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
cagagatgca
>AP000504_63714_63775 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
cacagcagcc
>AP000504_64760_64927 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
tctaggtaag
>AP000504_66908_67344 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
cccaggcagc
>AP000504_71741_72164 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
actgtggaat
>AP000504_72744_73649 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
tttaccataa
>AP000504_73962_74192 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
ctcatggcct
>AP000504_74520_74709 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
cctacctggg
>AP000504_74856_74931 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
ctcaccaatg
>AP000504_75374_75489 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
ctcaccatct
>AP000504_76058_76160 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
ctcaccaggc
>AP000504_77125_77207 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
ctcacttcac
>AP000504_77820_78148 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
ctcaccggct
>AP000504_79023_79187 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
tgattagaat
>AP000504_79451_80175 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
agcaggtctc
>AP000504_81318_81943 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
tgcaggtctc
>AP000504_83295_85730 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
ggctccccaa
>AP000504_85819_85964 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
gagatgagga
>AP000504_86305_86403 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
cttaccttga
>AP000504_86550_86648 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
ctcactgtag
>AP000504_86730_86803 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
ccaaccttca
>AP000504_87402_87556 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
ctcacatgcg
>AP000504_87948_88090 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
catacctcct
>AP000504_91393_91628 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
ccccgggcga
>AP000504_92264_92384 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
tttagagacc
>AP000504_94413_94530 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
ttcagatgaa
>AP000504_94645_94841 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
tgcagatgtt
>AP000504_95076_95129 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
cccagagtga
>AP000504_95289_95363 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
tgtagagtga
>AP000504_96214_96449 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
ttcagtgtcg
>AP000504_97518_97647 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
cacagccatc
>AP000504_98437_98634 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
cgcagcacga
>AP000504_98843_99095 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
ttcagatcaa
>AP000504_99439_99516 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
cccagattct
>AP000504_99847_99959 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.
cacaggacag
>AB000360_808_2266 [exon] Homo sapiens PIGC gene, complete cds.
cttttagtaa
>HSHBB_19289_19632 [exon] Human beta globin region on chromosome 11.
ggagccaaca
>HSHBB_19755_19977 [exon] Human beta globin region on chromosome 11.
catagactcc
>HSHBB_20833_21080 [exon] Human beta globin region on chromosome 11.
aacagctcct
>HSHBB_34478_34622 [exon] Human beta globin region on chromosome 11.
tccacacact
>HSHBB_34745_34967 [exon] Human beta globin region on chromosome 11.
cacaggctcc
>HSHBB_35854_36069 [exon] Human beta globin region on chromosome 11.
aacagctcct
>HSHBB_39414_39558 [exon] Human beta globin region on chromosome 11.
tccacacact
>HSHBB_39681_39903 [exon] Human beta globin region on chromosome 11.
cacaggctcc
>HSHBB_40770_40985 [exon] Human beta globin region on chromosome 11.
aacagctcct
>HSHBB_45710_45800 [exon] Human beta globin region on chromosome 11.
acactgtagt
>HSHBB_45922_46145 [exon] Human beta globin region on chromosome 11.
cacagtctcc
>HSHBB_46997_47124 [exon] Human beta globin region on chromosome 11.
cccagctctt
>HSHBB_54740_54881 [exon] Human beta globin region on chromosome 11.
tgcttacact
>HSHBB_55010_55232 [exon] Human beta globin region on chromosome 11.
ctcagattac
>HSHBB_56131_56389 [exon] Human beta globin region on chromosome 11.
cgcagctctt
>HSHBB_62137_62278 [exon] Human beta globin region on chromosome 11.
tgcttacatt
>HSHBB_62187_62278 [exon] Human beta globin region on chromosome 11.
acaccatggt
>HSHBB_62390_62408 [exon] Human beta globin region on chromosome 11.
attggtctat
>HSHBB_62409_62631 [exon] Human beta globin region on chromosome 11.
cttaggctgc
>HSHBB_63482_63742 [exon] Human beta globin region on chromosome 11.
cacagctcct
>GMGL01_363_460 [exon] Glycine max leghemoglobin gene or pseudogene (no mRNA detected).
gaaatatggg
>GMGL01_555_663 [exon] Glycine max leghemoglobin gene or pseudogene (no mRNA detected).
aataggatat
>GMGL01_2182_2286 [exon] Glycine max leghemoglobin gene or pseudogene (no mRNA detected).
tgtaggtgcg
>GMGL01_3065_3208 [exon] Glycine max leghemoglobin gene or pseudogene (no mRNA detected).
cgtaggtggt

Example 4

To extract the CDS region with the exons joined into one sequence:


% extractfeat tembl:hsfau1 -type CDS -join stdout 
Extract features from a sequence

>HSFAU1_782_1912 [CDS] H.sapiens fau 1 gene
atgcagctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacg
gtcgcccagatcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtc
gtgctcctggcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggag
gccctgactaccctggaagtagcaggccgcatgcttggaggtaaagtccatggttccctg
gcccgtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaag
aagaagacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtg
cccacctttggcaagaagaagggccccaatgccaactcttaa

Example 5

To write out the 7 residues around all phosphorylated residues in the tsw database:


% extractfeat tsw:*  -type mod_res -value phosphorylation* -before 3 -after -4 stdout 
Extract features from a sequence

>OPSD_HUMAN_343_343 [mod_res] RHODOPSIN.
TETSQVA
>PAXI_HUMAN_118_118 [mod_res] PAXILLIN.
EHVYSFP

Go to the input files for this example

Command line arguments

   Standard (Mandatory) qualifiers:
  [-sequence]          seqall     Sequence(s) filename and optional format, or
                                  reference (input USA)
  [-outseq]            seqout     [.] Sequence filename and
                                  optional format (output USA)

   Additional (Optional) qualifiers:
   -before             integer    [0] If this value is greater than 0 then
                                  that number of bases or residues before the
                                  feature are included in the extracted
                                  sequence. This allows you to get the context
                                  of the feature. If this value is negative
                                  then the start of the extracted sequence
                                  will be this number of bases/residues before
                                  the end of the feature. So a value of '10'
                                  will start the extraction 10 bases/residues
                                  before the start of the sequence, and a
                                  value of '-10' will start the extraction 10
                                  bases/residues before the end of the
                                  feature. The output sequence will be padded
                                  with 'N' or 'X' characters if the sequence
                                  starts after the required start of the
                                  extraction. (Any integer value)
   -after              integer    [0] If this value is greater than 0 then
                                  that number of bases or residues after the
                                  feature are included in the extracted
                                  sequence. This allows you to get the context
                                  of the feature. If this value is negative
                                  then the end of the extracted sequence will
                                  be this number of bases/residues after the
                                  start of the feature. So a value of '10'
                                  will end the extraction 10 bases/residues
                                  after the end of the sequence, and a value
                                  of '-10' will end the extraction 10
                                  bases/residues after the start of the
                                  feature. The output sequence will be padded
                                  with 'N' or 'X' characters if the sequence
                                  ends before the required end of the
                                  extraction. (Any integer value)
   -source             string     [*] By default any feature source in the
                                  feature table is shown. You can set this to
                                  match any feature source you wish to show.
                                  The source name is usually either the name
                                  of the program that detected the feature or
                                  it is the feature table (eg: EMBL) that the
                                  feature came from.
                                  The source may be wildcarded by using '*'.
                                  If you wish to show more than one source,
                                  separate their names with the character '|',
                                  eg:
                                  gene* | embl (Any string is accepted)
   -type               string     [*] By default every feature in the feature
                                  table is extracted. You can set this to be
                                  any feature type you wish to extract.
                                  See http://www3.ebi.ac.uk/Services/WebFeat/
                                  for a list of the EMBL feature types and see
                                  Appendix A of the Swissprot user manual in
                                  http://www.expasy.ch/txt/userman.txt for a
                                  list of the Swissprot feature types.
                                  The type may be wildcarded by using '*'.
                                  If you wish to extract more than one type,
                                  separate their names with the character '|',
                                  eg:
                                  *UTR | intron (Any string is accepted)
   -sense              integer    [0 - any sense, 1 - forward sense, -1 -
                                  reverse sense] By default any feature type
                                  in the feature table is extracted. You can
                                  set this to match any feature sense you
                                  wish. 0 - any sense, 1 - forward sense, -1 -
                                  reverse sense (Any integer value)
   -minscore           float      [0.0] If this is greater than or equal to
                                  the maximum score, then any score is
                                  permitted (Any numeric value)
   -maxscore           float      [0.0] If this is less than or equal to the
                                  maximum score, then any score is permitted
                                  (Any numeric value)
   -tag                string     [*] Tags are the types of extra values that
                                  a feature may have. For example in the EMBL
                                  feature table, a 'CDS' type of feature may
                                  have the tags '/codon', '/codon_start',
                                  '/db_xref', '/EC_number', '/evidence',
                                  '/exception', '/function', '/gene',
                                  '/label', '/map', '/note', '/number',
                                  '/partial', '/product', '/protein_id',
                                  '/pseudo', '/standard_name', '/translation',
                                  '/transl_except', '/transl_table', or
                                  '/usedin'. Some of these tags also have
                                  values, for example '/gene' can have the
                                  value of the gene name.
                                  By default any feature tag in the feature
                                  table is extracted. You can set this to
                                  match any feature tag you wish to show.
                                  The tag may be wildcarded by using '*'.
                                  If you wish to extract more than one tag,
                                  separate their names with the character '|',
                                  eg:
                                  gene | label (Any string is accepted)
   -value              string     [*] Tag values are the values associated
                                  with a feature tag. Tags are the types of
                                  extra values that a feature may have. For
                                  example in the EMBL feature table, a 'CDS'
                                  type of feature may have the tags '/codon',
                                  '/codon_start', '/db_xref', '/EC_number',
                                  '/evidence', '/exception', '/function',
                                  '/gene', '/label', '/map', '/note',
                                  '/number', '/partial', '/product',
                                  '/protein_id', '/pseudo', '/standard_name',
                                  '/translation', '/transl_except',
                                  '/transl_table', or '/usedin'. Only some of
                                  these tags can have values, for example
                                  '/gene' can have the value of the gene name.
                                  By default any feature tag value in the
                                  feature table is shown. You can set this to
                                  match any feature tag valueyou wish to show.
                                  The tag value may be wildcarded by using
                                  '*'.
                                  If you wish to show more than one tag value,
                                  separate their names with a space or the
                                  character '|', eg:
                                  pax* | 10 (Any string is accepted)
   -join               boolean    [N] Some features, such as CDS (coding
                                  sequence) and mRNA are composed of introns
                                  concatenated together. There may be other
                                  forms of 'joined' sequence, depending on the
                                  feature table. If this option is set TRUE,
                                  then any group of these features will be
                                  output as a single sequence. If the 'before'
                                  and 'after' qualifiers have been set, then
                                  only the sequence before the first feature
                                  and after the last feature are added.
   -featinname         boolean    [N] To aid you in identifying the type of
                                  feature that has been output, the type of
                                  feature is added to the start of the
                                  description of the output sequence.
                                  Sometimes the description of a sequence is
                                  lost in subsequent processing of the
                                  sequences file, so it is useful for the type
                                  to be a part of the sequence ID name. If
                                  you set this to be TRUE then the name is
                                  added to the ID name of the output sequence.
   -describe           string     To aid you in identifying some further
                                  properties of a feature that has been
                                  output, this lets you specify one or more
                                  tag names that should be added to the output
                                  sequence Description text, together with
                                  their values (if any). For example, if this
                                  is set to be 'gene', then if any output
                                  feature has the tag (for example)
                                  '/gene=BRCA1' associated with it, then the
                                  text '(gene=BRCA1)' will be added to the
                                  Description line. Tags are the types of
                                  extra values that a feature may have. For
                                  example in the EMBL feature table, a 'CDS'
                                  type of feature may have the tags '/codon',
                                  '/codon_start', '/db_xref', '/EC_number',
                                  '/evidence', '/exception', '/function',
                                  '/gene', '/label', '/map', '/note',
                                  '/number', '/partial', '/product',
                                  '/protein_id', '/pseudo', '/standard_name',
                                  '/translation', '/transl_except',
                                  '/transl_table', or '/usedin'. Some of these
                                  tags also have values, for example '/gene'
                                  can have the value of the gene name.
                                  By default no feature tag is displayed. You
                                  can set this to match any feature tag you
                                  wish to show.
                                  The tag may be wildcarded by using '*'.
                                  If you wish to extract more than one tag,
                                  separate their names with the character '|',
                                  eg:
                                  gene | label (Any string is accepted)

   Advanced (Unprompted) qualifiers: (none)
   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin1            integer    Start of each sequence to be used
   -send1              integer    End of each sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -sformat1           string     Input sequence format
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name

   "-outseq" associated qualifiers
   -osformat2          string     Output seq format
   -osextension2       string     File name extension
   -osname2            string     Base file name
   -osdirectory2       string     Output directory
   -osdbname2          string     Database name to add
   -ossingle2          boolean    Separate file for each entry
   -oufo2              string     UFO features
   -offormat2          string     Features format
   -ofname2            string     Features file name
   -ofdirectory2       string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write standard output
   -filter             boolean    Read standard input, write standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages

Standard (Mandatory) qualifiers Allowed values Default
[-sequence]
(Parameter 1)
Sequence(s) filename and optional format, or reference (input USA) Readable sequence(s) Required
[-outseq]
(Parameter 2)
Sequence filename and optional format (output USA) Writeable sequence <*>.format
Additional (Optional) qualifiers Allowed values Default
-before If this value is greater than 0 then that number of bases or residues before the feature are included in the extracted sequence. This allows you to get the context of the feature. If this value is negative then the start of the extracted sequence will be this number of bases/residues before the end of the feature. So a value of '10' will start the extraction 10 bases/residues before the start of the sequence, and a value of '-10' will start the extraction 10 bases/residues before the end of the feature. The output sequence will be padded with 'N' or 'X' characters if the sequence starts after the required start of the extraction. Any integer value 0
-after If this value is greater than 0 then that number of bases or residues after the feature are included in the extracted sequence. This allows you to get the context of the feature. If this value is negative then the end of the extracted sequence will be this number of bases/residues after the start of the feature. So a value of '10' will end the extraction 10 bases/residues after the end of the sequence, and a value of '-10' will end the extraction 10 bases/residues after the start of the feature. The output sequence will be padded with 'N' or 'X' characters if the sequence ends before the required end of the extraction. Any integer value 0
-source By default any feature source in the feature table is shown. You can set this to match any feature source you wish to show. The source name is usually either the name of the program that detected the feature or it is the feature table (eg: EMBL) that the feature came from. The source may be wildcarded by using '*'. If you wish to show more than one source, separate their names with the character '|', eg: gene* | embl Any string is accepted *
-type By default every feature in the feature table is extracted. You can set this to be any feature type you wish to extract. See http://www3.ebi.ac.uk/Services/WebFeat/ for a list of the EMBL feature types and see Appendix A of the Swissprot user manual in http://www.expasy.ch/txt/userman.txt for a list of the Swissprot feature types. The type may be wildcarded by using '*'. If you wish to extract more than one type, separate their names with the character '|', eg: *UTR | intron Any string is accepted *
-sense By default any feature type in the feature table is extracted. You can set this to match any feature sense you wish. 0 - any sense, 1 - forward sense, -1 - reverse sense Any integer value 0 - any sense, 1 - forward sense, -1 - reverse sense
-minscore If this is greater than or equal to the maximum score, then any score is permitted Any numeric value 0.0
-maxscore If this is less than or equal to the maximum score, then any score is permitted Any numeric value 0.0
-tag Tags are the types of extra values that a feature may have. For example in the EMBL feature table, a 'CDS' type of feature may have the tags '/codon', '/codon_start', '/db_xref', '/EC_number', '/evidence', '/exception', '/function', '/gene', '/label', '/map', '/note', '/number', '/partial', '/product', '/protein_id', '/pseudo', '/standard_name', '/translation', '/transl_except', '/transl_table', or '/usedin'. Some of these tags also have values, for example '/gene' can have the value of the gene name. By default any feature tag in the feature table is extracted. You can set this to match any feature tag you wish to show. The tag may be wildcarded by using '*'. If you wish to extract more than one tag, separate their names with the character '|', eg: gene | label Any string is accepted *
-value Tag values are the values associated with a feature tag. Tags are the types of extra values that a feature may have. For example in the EMBL feature table, a 'CDS' type of feature may have the tags '/codon', '/codon_start', '/db_xref', '/EC_number', '/evidence', '/exception', '/function', '/gene', '/label', '/map', '/note', '/number', '/partial', '/product', '/protein_id', '/pseudo', '/standard_name', '/translation', '/transl_except', '/transl_table', or '/usedin'. Only some of these tags can have values, for example '/gene' can have the value of the gene name. By default any feature tag value in the feature table is shown. You can set this to match any feature tag valueyou wish to show. The tag value may be wildcarded by using '*'. If you wish to show more than one tag value, separate their names with a space or the character '|', eg: pax* | 10 Any string is accepted *
-join Some features, such as CDS (coding sequence) and mRNA are composed of introns concatenated together. There may be other forms of 'joined' sequence, depending on the feature table. If this option is set TRUE, then any group of these features will be output as a single sequence. If the 'before' and 'after' qualifiers have been set, then only the sequence before the first feature and after the last feature are added. Boolean value Yes/No No
-featinname To aid you in identifying the type of feature that has been output, the type of feature is added to the start of the description of the output sequence. Sometimes the description of a sequence is lost in subsequent processing of the sequences file, so it is useful for the type to be a part of the sequence ID name. If you set this to be TRUE then the name is added to the ID name of the output sequence. Boolean value Yes/No No
-describe To aid you in identifying some further properties of a feature that has been output, this lets you specify one or more tag names that should be added to the output sequence Description text, together with their values (if any). For example, if this is set to be 'gene', then if any output feature has the tag (for example) '/gene=BRCA1' associated with it, then the text '(gene=BRCA1)' will be added to the Description line. Tags are the types of extra values that a feature may have. For example in the EMBL feature table, a 'CDS' type of feature may have the tags '/codon', '/codon_start', '/db_xref', '/EC_number', '/evidence', '/exception', '/function', '/gene', '/label', '/map', '/note', '/number', '/partial', '/product', '/protein_id', '/pseudo', '/standard_name', '/translation', '/transl_except', '/transl_table', or '/usedin'. Some of these tags also have values, for example '/gene' can have the value of the gene name. By default no feature tag is displayed. You can set this to match any feature tag you wish to show. The tag may be wildcarded by using '*'. If you wish to extract more than one tag, separate their names with the character '|', eg: gene | label Any string is accepted An empty string is accepted
Advanced (Unprompted) qualifiers Allowed values Default
(none)

Input file format

extractfeat reads normal sequences with features.

Feature tables in Swissprot, EMBL, GFF, etc. format can be added using '-ufo featurefile' on the command line.

Input files for usage example

'tembl:hsfau1' is a sequence entry in the example nucleic acid database 'tembl'

Database entry: tembl:hsfau1

ID   HSFAU1     standard; DNA; HUM; 2016 BP.
XX
AC   X65921; S45242;
XX
SV   X65921.1
XX
DT   13-MAY-1992 (Rel. 31, Created)
DT   21-JUL-1993 (Rel. 36, Last updated, Version 5)
XX
DE   H.sapiens fau 1 gene
XX
KW   fau 1 gene.
XX
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Primates; Catarrhini; Hominidae; Homo.
XX
RN   [1]
RP   1-2016
RA   Kas K.;
RT   ;
RL   Submitted (29-APR-1992) to the EMBL/GenBank/DDBJ databases.
RL   K. Kas, University of Antwerp, Dept of Biochemistry T3.22,
RL   Universiteitsplein 1, 2610 Wilrijk, BELGIUM
XX
RN   [2]
RP   1-2016
RX   MEDLINE; 92412144.
RA   Kas K., Michiels L., Merregaert J.;
RT   "Genomic structure and expression of the human fau gene: encoding the
RT   ribosomal protein S30 fused to a ubiquitin-like protein.";
RL   Biochem. Biophys. Res. Commun. 187:927-933(1992).
XX
DR   SWISS-PROT; P35544; UBIM_HUMAN.
DR   SWISS-PROT; Q05472; RS30_HUMAN.
XX
FH   Key             Location/Qualifiers
FH
FT   source          1..2016
FT                   /db_xref="taxon:9606"
FT                   /organism="Homo sapiens"
FT                   /clone_lib="CML cosmid"
FT                   /clone="15.1"
FT   mRNA            join(408..504,774..856,951..1095,1557..1612,1787..>1912)
FT                   /gene="fau 1"
FT   exon            408..504
FT                   /number=1
FT   intron          505..773
FT                   /number=1
FT   exon            774..856


  [Part of this file has been deleted for brevity]

FT                   RAKRRMQYNRRFVNVVPTFGKKKGPNANS"
FT   intron          857..950
FT                   /number=2
FT   exon            951..1095
FT                   /number=3
FT   intron          1096..1556
FT                   /number=3
FT   exon            1557..1612
FT                   /number=4
FT   intron          1613..1786
FT                   /number=4
FT   exon            1787..>1912
FT                   /number=5
FT   polyA_signal    1938..1943
XX
SQ   Sequence 2016 BP; 421 A; 562 C; 538 G; 495 T; 0 other;
     ctaccatttt ccctctcgat tctatatgta cactcgggac aagttctcct gatcgaaaac        60
     ggcaaaacta aggccccaag taggaatgcc ttagttttcg gggttaacaa tgattaacac       120
     tgagcctcac acccacgcga tgccctcagc tcctcgctca gcgctctcac caacagccgt       180
     agcccgcagc cccgctggac accggttctc catccccgca gcgtagcccg gaacatggta       240
     gctgccatct ttacctgcta cgccagcctt ctgtgcgcgc aactgtctgg tcccgccccg       300
     tcctgcgcga gctgctgccc aggcaggttc gccggtgcga gcgtaaaggg gcggagctag       360
     gactgccttg ggcggtacaa atagcaggga accgcgcggt cgctcagcag tgacgtgaca       420
     cgcagcccac ggtctgtact gacgcgccct cgcttcttcc tctttctcga ctccatcttc       480
     gcggtagctg ggaccgccgt tcaggtaaga atggggcctt ggctggatcc gaagggcttg       540
     tagcaggttg gctgcggggt cagaaggcgc ggggggaacc gaagaacggg gcctgctccg       600
     tggccctgct ccagtcccta tccgaactcc ttgggaggca ctggccttcc gcacgtgagc       660
     cgccgcgacc accatcccgt cgcgatcgtt tctggaccgc tttccactcc caaatctcct       720
     ttatcccaga gcatttcttg gcttctctta caagccgtct tttctttact cagtcgccaa       780
     tatgcagctc tttgtccgcg cccaggagct acacaccttc gaggtgaccg gccaggaaac       840
     ggtcgcccag atcaaggtaa ggctgcttgg tgcgccctgg gttccatttt cttgtgctct       900
     tcactctcgc ggcccgaggg aacgcttacg agccttatct ttccctgtag gctcatgtag       960
     cctcactgga gggcattgcc ccggaagatc aagtcgtgct cctggcaggc gcgcccctgg      1020
     aggatgaggc cactctgggc cagtgcgggg tggaggccct gactaccctg gaagtagcag      1080
     gccgcatgct tggaggtgag tgagagagga atgttctttg aagtaccggt aagcgtctag      1140
     tgagtgtggg gtgcatagtc ctgacagctg agtgtcacac ctatggtaat agagtacttc      1200
     tcactgtctt cagttcagag tgattcttcc tgtttacatc cctcatgttg aacacagacg      1260
     tccatgggag actgagccag agtgtagttg tatttcagtc acatcacgag atcctagtct      1320
     ggttatcagc ttccacacta aaaattaggt cagaccaggc cccaaagtgc tctataaatt      1380
     agaagctgga agatcctgaa atgaaactta agatttcaag gtcaaatatc tgcaactttg      1440
     ttctcattac ctattgggcg cagcttctct ttaaaggctt gaattgagaa aagaggggtt      1500
     ctgctgggtg gcaccttctt gctcttacct gctggtgcct tcctttccca ctacaggtaa      1560
     agtccatggt tccctggccc gtgctggaaa agtgagaggt cagactccta aggtgagtga      1620
     gagtattagt ggtcatggtg ttaggacttt ttttcctttc acagctaaac caagtccctg      1680
     ggctcttact cggtttgcct tctccctccc tggagatgag cctgagggaa gggatgctag      1740
     gtgtggaaga caggaaccag ggcctgatta accttccctt ctccaggtgg ccaaacagga      1800
     gaagaagaag aagaagacag gtcgggctaa gcggcggatg cagtacaacc ggcgctttgt      1860
     caacgttgtg cccacctttg gcaagaagaa gggccccaat gccaactctt aagtcttttg      1920
     taattctggc tttctctaat aaaaaagcca cttagttcag tcatcgcatt gtttcatctt      1980
     tacttgcaag gcctcaggga gaggtgtgct tctcgg                                2016
//

Input files for usage example 5

'tsw:*' is a sequence entry in the example protein database 'tsw'

Output file format

The sequences of the specified features are written out.

The ID name of the sequence is formed from the original sequence name with the start and end positions of the feature appended to it. So if the feature came from a sequence with an ID name of 'XYZ' from positions 10 to 22, then the resulting ID name of the feature sequence will be 'XYZ_10_22'

The name of the type of feature is added to the start of the description of the sequence in brackets, e.g.: '[exon]'.

The sequence is written out as a normal sequence.

If the feature is in the reverse sense of a nucleic acid sequence, then it is reverse-complemented before being written.

Data files

None.

Notes

If a feature is specified as being a part of a different sequence entry in a database, then this feature is ignored.

If you are extracting 'joined' features and one of more of the component features is in a different sequence entry, then the whole joined feature is ignored.

References

None.

Warnings

None.

Diagnostic Error Messages

If the end position of the sequence to be written is less than the start position, then the warning message "Extraction region end less than start for feature type [start-end] in ID name" is written and no sequence is output.

Exit status

It always exits with status 0.

Known bugs

None.

See also

Program nameDescription
biosed Replace or delete sequence sections
codcopy Reads and writes a codon usage table
coderet Extract CDS, mRNA and translations from feature tables
cutseq Removes a specified section from a sequence
degapseq Removes gap characters from sequences
descseq Alter the name or description of a sequence
entret Reads and writes (returns) flatfile entries
extractalign Extract regions from a sequence alignment
extractseq Extract regions from a sequence
listor Write a list file of the logical OR of two sets of sequences
makenucseq Creates random nucleotide sequences
makeprotseq Creates random protein sequences
maskfeat Mask off features of a sequence
maskseq Mask off regions of a sequence
newseq Type in a short new sequence
noreturn Removes carriage return from ASCII files
notseq Exclude a set of sequences and write out the remaining ones
nthseq Writes one sequence from a multiple set of sequences
pasteseq Insert one sequence into another
revseq Reverse and complement a sequence
seqret Reads and writes (returns) sequences
seqretsplit Reads and writes (returns) sequences in individual files
showfeat Show features of a sequence
skipseq Reads and writes (returns) sequences, skipping first few
splitter Split a sequence into (overlapping) smaller sequences
trimest Trim poly-A tails off EST sequences
trimseq Trim ambiguous bits off the ends of sequences
twofeat Finds neighbouring pairs of features in sequences
union Reads sequence fragments and builds one sequence
vectorstrip Strips out DNA between a pair of vector sequences
yank Reads a sequence range, appends the full USA to a list file

Author(s)

Gary Williams (gwilliam © rfcgr.mrc.ac.uk)
MRC Rosalind Franklin Centre for Genomics Research Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SB, UK

History

Written (Dec 12 2001) - Gary Williams

Added '-join' parameter (June 2002) - Gary Williams

Target users

This program is intended to be used by everyone and everything, from naive users to embedded scripts.

Comments

None