degapseq

 

Function

Removes non-alphabetic (e.g. gap) characters from sequences

Description

degapseq reads one or more sequences and writes them out again but stripped of any non-alphabetic characters. It's main purpose is to remove gap characters from aligned sequences, but it will also remove such things as the symbol for translation STOP ('*') in a protein sequence.

Usage

Here is a sample session with degapseq


% degapseq dnagap.fasta nogaps.seq 
Removes non-alphabetic (e.g. gap) characters from sequences

Go to the input files for this example
Go to the output files for this example

Command line arguments

   Standard (Mandatory) qualifiers:
  [-sequence]          seqall     (Gapped) sequence(s) filename and optional
                                  format, or reference (input USA)
  [-outseq]            seqoutall  [.] Sequence set(s)
                                  filename and optional format (output USA)

   Additional (Optional) qualifiers: (none)
   Advanced (Unprompted) qualifiers: (none)
   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin1            integer    Start of each sequence to be used
   -send1              integer    End of each sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -sformat1           string     Input sequence format
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name

   "-outseq" associated qualifiers
   -osformat2          string     Output seq format
   -osextension2       string     File name extension
   -osname2            string     Base file name
   -osdirectory2       string     Output directory
   -osdbname2          string     Database name to add
   -ossingle2          boolean    Separate file for each entry
   -oufo2              string     UFO features
   -offormat2          string     Features format
   -ofname2            string     Features file name
   -ofdirectory2       string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write first file to standard output
   -filter             boolean    Read first file from standard input, write
                                  first file to standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages

Standard (Mandatory) qualifiers Allowed values Default
[-sequence]
(Parameter 1)
(Gapped) sequence(s) filename and optional format, or reference (input USA) Readable sequence(s) Required
[-outseq]
(Parameter 2)
Sequence set(s) filename and optional format (output USA) Writeable sequence(s) <*>.format
Additional (Optional) qualifiers Allowed values Default
(none)
Advanced (Unprompted) qualifiers Allowed values Default
(none)

Input file format

Any valid input sequence USA is allowed.

The input sequence can be nucleic or protein.

The input sequence can be gapped or ungapped.

Input files for usage example

File: dnagap.fasta

>FASTA F10002 FASTA FORMAT DNA SEQUENCE
ACGT....ACGTACGTACGTACGTACGTACGTACGTACGT
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
ACGTACGTACGTACGTACGT

Output file format

The output is a sequence with no gaps.

Output files for usage example

File: nogaps.seq

>FASTA F10002 FASTA FORMAT DNA SEQUENCE
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
ACGTACGTACGTACGTACGTACGTACGTACGTACGT

Data files

None.

Notes

There are many different formats for storing molecular sequences in files. Some formats are specifically for aligned sequences, where gaps are inserted into the sequences for purposes of alignment. Gaps are indicated with different characters depending on the format in question, but commonly include '.', '-' and '~'. Some formats use more than one type of character to indicate different types of gaps, for example gaps at the sequence ends, internal gaps, gaps inserted by a program and gaps inserted manually by a person editing the alignment may all be denoted with different characters.

EMBOSS uses the dash character ('-') only to indicate gaps. When an EMBOSS program reads a sequence with gaps, all gap characters are changed internally to a dash ('-'). Thus any distinguishing characters for different gap types are convered to a '-' on output.

References

None.

Warnings

It will remove '*' characters from protein sequences as well as removing the gap characters.

Diagnostic Error Messages

None.

Exit status

It always exits with status 0.

Known bugs

None.

See also

Program name Description
aligncopy Reads and writes alignments
aligncopypair Reads and writes pairs from alignments
biosed Replace or delete sequence sections
codcopy Copy and reformat a codon usage table
cutseq Removes a section from a sequence
descseq Alter the name or description of a sequence
entret Retrieves sequence entries from flatfile databases and files
extractalign Extract regions from a sequence alignment
extractfeat Extract features from sequence(s)
extractseq Extract regions from a sequence
featcopy Reads and writes a feature table
featreport Reads and writes a feature table
listor Write a list file of the logical OR of two sets of sequences
makenucseq Create random nucleotide sequences
makeprotseq Create random protein sequences
maskambignuc Masks all ambiguity characters in nucleotide sequences with N
maskambigprot Masks all ambiguity characters in protein sequences with X
maskfeat Write a sequence with masked features
maskseq Write a sequence with masked regions
newseq Create a sequence file from a typed-in sequence
nohtml Remove mark-up (e.g. HTML tags) from an ASCII text file
noreturn Remove carriage return from ASCII files
nospace Remove all whitespace from an ASCII text file
notab Replace tabs with spaces in an ASCII text file
notseq Write to file a subset of an input stream of sequences
nthseq Write to file a single sequence from an input stream of sequences
pasteseq Insert one sequence into another
revseq Reverse and complement a nucleotide sequence
seqret Reads and writes (returns) sequences
seqretsplit Reads sequences and writes them to individual files
sizeseq Sort sequences by size
skipredundant Remove redundant sequences from an input set
skipseq Reads and writes (returns) sequences, skipping first few
splitter Split sequence(s) into smaller sequences
trimest Remove poly-A tails from nucleotide sequences
trimseq Remove unwanted characters from start and end of sequence(s)
trimspace Remove extra whitespace from an ASCII text file
union Concatenate multiple sequences into a single sequence
vectorstrip Removes vectors from the ends of nucleotide sequence(s)
yank Add a sequence reference (a full USA) to a list file

Author(s)

Gary Williams (gwilliam © rfcgr.mrc.ac.uk)
MRC Rosalind Franklin Centre for Genomics Research Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SB, UK

History

Written (6 March 2001) - Gary Williams

Target users

This program is intended to be used by everyone and everything, from naive users to embedded scripts.

Comments

None