descseq |
Please help by correcting and extending the Wiki pages.
descseq reads a sequence and writes it to file but with a different name and / or description. All other records including the sequence itself are left unaltered.
Set the name of a sequence to "myclone23"
% descseq -seq dna.text -out clone23.seq -name 'myclone23' Alter the name or description of a sequence. |
Go to the input files for this example
Go to the output files for this example
Example 2
Set the description of a sequence to "This is my clone number 244"
% descseq -seq dna.text -out xy24.seq -desc 'This is my clone number 244' Alter the name or description of a sequence. |
Go to the output files for this example
Example 3
Append some text to the description of a sequence
% descseq -seq dna.text -out est4.seq -desc ' (submitted)' -append Alter the name or description of a sequence. |
Go to the output files for this example
Standard (Mandatory) qualifiers: [-sequence] sequence (Gapped) sequence filename and optional format, or reference (input USA) [-outseq] seqout [ |
Standard (Mandatory) qualifiers | Allowed values | Default | |
---|---|---|---|
[-sequence] (Parameter 1) |
(Gapped) sequence filename and optional format, or reference (input USA) | Readable sequence | Required |
[-outseq] (Parameter 2) |
Sequence filename and optional format (output USA) | Writeable sequence | <*>.format |
Additional (Optional) qualifiers | Allowed values | Default | |
-name | Name of the sequence | Any string is accepted | An empty string is accepted |
-description | Description of the sequence | Any string is accepted | An empty string is accepted |
Advanced (Unprompted) qualifiers | Allowed values | Default | |
-append | This allows you to append the name or description you have given on to the end of the existing name or description of the sequence. | Boolean value Yes/No | No |
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTAC GTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT |
>myclone23 ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT |
>EMBOSS_001 This is my clone number 244 ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT |
>EMBOSS_001 (submitted) ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT |
Most sequence formats allow, at the very minimum, a name for the sequence and some comments to be stored in the sequence file. descseq let's you change the sequence name and / or description, and is far more convenient and less error-prone than using the editor for editing.
The default action is to replace the existing name or description with your new one, but by using the qualifier -append what you enter is appended to the existing name or description. Note that if you append to a description, no space is inserted by default bewteen the existing description and your appended text. You have to put in a space yourself if you require one.
Program name | Description |
---|---|
aligncopy | Reads and writes alignments |
aligncopypair | Reads and writes pairs from alignments |
biosed | Replace or delete sequence sections |
codcopy | Copy and reformat a codon usage table |
cutseq | Removes a section from a sequence |
degapseq | Removes non-alphabetic (e.g. gap) characters from sequences |
entret | Retrieves sequence entries from flatfile databases and files |
extractalign | Extract regions from a sequence alignment |
extractfeat | Extract features from sequence(s) |
extractseq | Extract regions from a sequence |
featcopy | Reads and writes a feature table |
featreport | Reads and writes a feature table |
listor | Write a list file of the logical OR of two sets of sequences |
makenucseq | Create random nucleotide sequences |
makeprotseq | Create random protein sequences |
maskambignuc | Masks all ambiguity characters in nucleotide sequences with N |
maskambigprot | Masks all ambiguity characters in protein sequences with X |
maskfeat | Write a sequence with masked features |
maskseq | Write a sequence with masked regions |
newseq | Create a sequence file from a typed-in sequence |
nohtml | Remove mark-up (e.g. HTML tags) from an ASCII text file |
noreturn | Remove carriage return from ASCII files |
nospace | Remove all whitespace from an ASCII text file |
notab | Replace tabs with spaces in an ASCII text file |
notseq | Write to file a subset of an input stream of sequences |
nthseq | Write to file a single sequence from an input stream of sequences |
nthseqset | Reads and writes (returns) one set of sequences from many |
pasteseq | Insert one sequence into another |
revseq | Reverse and complement a nucleotide sequence |
seqret | Reads and writes (returns) sequences |
seqretsetall | Reads and writes (returns) many sets of sequences |
seqretsplit | Reads sequences and writes them to individual files |
sizeseq | Sort sequences by size |
skipredundant | Remove redundant sequences from an input set |
skipseq | Reads and writes (returns) sequences, skipping first few |
splitsource | Split sequence(s) into original source sequences |
splitter | Split sequence(s) into smaller sequences |
trimest | Remove poly-A tails from nucleotide sequences |
trimseq | Remove unwanted characters from start and end of sequence(s) |
trimspace | Remove extra whitespace from an ASCII text file |
union | Concatenate multiple sequences into a single sequence |
vectorstrip | Removes vectors from the ends of nucleotide sequence(s) |
yank | Add a sequence reference (a full USA) to a list file |