plotorf

 

Wiki

The master copies of EMBOSS documentation are available at http://emboss.open-bio.org/wiki/Appdocs on the EMBOSS Wiki.

Please help by correcting and extending the Wiki pages.

Function

Plot potential open reading frames in a nucleotide sequence

Description

plotorf plots potential open reading frames (ORFs) for an input nucleotide sequence. ORFs in this program are defined as being regions between the specified START and STOP codons. A graphical representation of where the open reading frames are in all 6 reading frames is shown. The ORFs are displayed as blue boxes.

Algorithm

ORFs in this program are defined as being regions between START and STOP codons. The default START codon is: ATG. The default STOP codons are: TAA,TAG,TGA. You can specify your own set of start and stop codons using the -start and -stop qualifiers.

Usage

Here is a sample session with plotorf


% plotorf 
Plot potential open reading frames in a nucleotide sequence
Input nucleotide sequence: tembl:x13776
Graph type [x11]: cps

Created plotorf.ps

Go to the input files for this example
Go to the output files for this example

Example 2

An example of specifying your own START and STOP codons with a mitochondrial sequence would be:


% plotorf -start ATT,ATC,ATA,ATG,GTG -stop TAA,TAG,AGA,AGG 
Plot potential open reading frames in a nucleotide sequence
Input nucleotide sequence: mito.seq
Graph type [x11]: cps

Created plotorf.ps

Go to the input files for this example
Go to the output files for this example

Command line arguments

   Standard (Mandatory) qualifiers:
  [-sequence]          sequence   Nucleotide sequence filename and optional
                                  format, or reference (input USA)
   -graph              xygraph    [$EMBOSS_GRAPHICS value, or x11] Graph type
                                  (ps, hpgl, hp7470, hp7580, meta, cps, x11,
                                  tekt, tek, none, data, das, xterm, png, gif)

   Additional (Optional) qualifiers: (none)
   Advanced (Unprompted) qualifiers:
   -start              string     [ATG] Start codons (Any string is accepted)
   -stop               string     [TAA,TAG,TGA] Stop codons (Any string is
                                  accepted)

   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin1            integer    Start of the sequence to be used
   -send1              integer    End of the sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -sformat1           string     Input sequence format
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name

   "-graph" associated qualifiers
   -gprompt            boolean    Graph prompting
   -gdesc              string     Graph description
   -gtitle             string     Graph title
   -gsubtitle          string     Graph subtitle
   -gxtitle            string     Graph x axis title
   -gytitle            string     Graph y axis title
   -goutfile           string     Output file for non interactive displays
   -gdirectory         string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write first file to standard output
   -filter             boolean    Read first file from standard input, write
                                  first file to standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages

Standard (Mandatory) qualifiers Allowed values Default
[-sequence]
(Parameter 1)
Nucleotide sequence filename and optional format, or reference (input USA) Readable sequence Required
-graph Graph type EMBOSS has a list of known devices, including ps, hpgl, hp7470, hp7580, meta, cps, x11, tekt, tek, none, data, das, xterm, png, gif EMBOSS_GRAPHICS value, or x11
Additional (Optional) qualifiers Allowed values Default
(none)
Advanced (Unprompted) qualifiers Allowed values Default
-start Start codons Any string is accepted ATG
-stop Stop codons Any string is accepted TAA,TAG,TGA

Input file format

Any nucleic acid sequence.

Input files for usage example

'tembl:x13776' is a sequence entry in the example nucleic acid database 'tembl'

Database entry: tembl:x13776

ID   X13776; SV 1; linear; genomic DNA; STD; PRO; 2167 BP.
XX
AC   X13776; M43175;
XX
DT   19-APR-1989 (Rel. 19, Created)
DT   14-NOV-2006 (Rel. 89, Last updated, Version 24)
XX
DE   Pseudomonas aeruginosa amiC and amiR gene for aliphatic amidase regulation
XX
KW   aliphatic amidase regulator; amiC gene; amiR gene.
XX
OS   Pseudomonas aeruginosa
OC   Bacteria; Proteobacteria; Gammaproteobacteria; Pseudomonadales;
OC   Pseudomonadaceae; Pseudomonas.
XX
RN   [1]
RP   1167-2167
RA   Rice P.M.;
RT   ;
RL   Submitted (16-DEC-1988) to the EMBL/GenBank/DDBJ databases.
RL   Rice P.M., EMBL, Postfach 10-2209, Meyerhofstrasse 1, 6900 Heidelberg, FRG.
XX
RN   [2]
RP   1167-2167
RX   DOI; 10.1016/0014-5793(89)80249-2.
RX   PUBMED; 2495988.
RA   Lowe N., Rice P.M., Drew R.E.;
RT   "Nucleotide sequence of the aliphatic amidase regulator gene (amiR) of
RT   Pseudomonas aeruginosa";
RL   FEBS Lett. 246(1-2):39-43(1989).
XX
RN   [3]
RP   1-1292
RX   PUBMED; 1907262.
RA   Wilson S., Drew R.;
RT   "Cloning and DNA sequence of amiC, a new gene regulating expression of the
RT   Pseudomonas aeruginosa aliphatic amidase, and purification of the amiC
RT   product";
RL   J. Bacteriol. 173(16):4914-4921(1991).
XX
RN   [4]
RP   1-2167
RA   Rice P.M.;
RT   ;
RL   Submitted (04-SEP-1991) to the EMBL/GenBank/DDBJ databases.
RL   Rice P.M., EMBL, Postfach 10-2209, Meyerhofstrasse 1, 6900 Heidelberg, FRG.
XX
DR   GOA; Q51417.
DR   InterPro; IPR003211; AmiSUreI_transpt.
DR   UniProtKB/Swiss-Prot; Q51417; AMIS_PSEAE.


  [Part of this file has been deleted for brevity]

FT                   /replace=""
FT                   /note="ClaI fragment deleted in pSW36,  constitutive
FT                   phenotype"
FT   misc_feature    1
FT                   /note="last base of an XhoI site"
FT   misc_feature    648..653
FT                   /note="end of 658bp XhoI fragment, deletion in  pSW3 causes
FT                   constitutive expression of amiE"
FT   conflict        1281
FT                   /replace="g"
FT                   /citation=[3]
XX
SQ   Sequence 2167 BP; 363 A; 712 C; 730 G; 362 T; 0 other;
     ggtaccgctg gccgagcatc tgctcgatca ccaccagccg ggcgacggga actgcacgat        60
     ctacctggcg agcctggagc acgagcgggt tcgcttcgta cggcgctgag cgacagtcac       120
     aggagaggaa acggatggga tcgcaccagg agcggccgct gatcggcctg ctgttctccg       180
     aaaccggcgt caccgccgat atcgagcgct cgcacgcgta tggcgcattg ctcgcggtcg       240
     agcaactgaa ccgcgagggc ggcgtcggcg gtcgcccgat cgaaacgctg tcccaggacc       300
     ccggcggcga cccggaccgc tatcggctgt gcgccgagga cttcattcgc aaccgggggg       360
     tacggttcct cgtgggctgc tacatgtcgc acacgcgcaa ggcggtgatg ccggtggtcg       420
     agcgcgccga cgcgctgctc tgctacccga ccccctacga gggcttcgag tattcgccga       480
     acatcgtcta cggcggtccg gcgccgaacc agaacagtgc gccgctggcg gcgtacctga       540
     ttcgccacta cggcgagcgg gtggtgttca tcggctcgga ctacatctat ccgcgggaaa       600
     gcaaccatgt gatgcgccac ctgtatcgcc agcacggcgg cacggtgctc gaggaaatct       660
     acattccgct gtatccctcc gacgacgact tgcagcgcgc cgtcgagcgc atctaccagg       720
     cgcgcgccga cgtggtcttc tccaccgtgg tgggcaccgg caccgccgag ctgtatcgcg       780
     ccatcgcccg tcgctacggc gacggcaggc ggccgccgat cgccagcctg accaccagcg       840
     aggcggaggt ggcgaagatg gagagtgacg tggcagaggg gcaggtggtg gtcgcgcctt       900
     acttctccag catcgatacg cccgccagcc gggccttcgt ccaggcctgc catggtttct       960
     tcccggagaa cgcgaccatc accgcctggg ccgaggcggc ctactggcag accttgttgc      1020
     tcggccgcgc cgcgcaggcc gcaggcaact ggcgggtgga agacgtgcag cggcacctgt      1080
     acgacatcga catcgacgcg ccacaggggc cggtccgggt ggagcgccag aacaaccaca      1140
     gccgcctgtc ttcgcgcatc gcggaaatcg atgcgcgcgg cgtgttccag gtccgctggc      1200
     agtcgcccga accgattcgc cccgaccctt atgtcgtcgt gcataacctc gacgactggt      1260
     ccgccagcat gggcggggga ccgctcccat gagcgccaac tcgctgctcg gcagcctgcg      1320
     cgagttgcag gtgctggtcc tcaacccgcc gggggaggtc agcgacgccc tggtcttgca      1380
     gctgatccgc atcggttgtt cggtgcgcca gtgctggccg ccgccggaag ccttcgacgt      1440
     gccggtggac gtggtcttca ccagcatttt ccagaatggc caccacgacg agatcgctgc      1500
     gctgctcgcc gccgggactc cgcgcactac cctggtggcg ctggtggagt acgaaagccc      1560
     cgcggtgctc tcgcagatca tcgagctgga gtgccacggc gtgatcaccc agccgctcga      1620
     tgcccaccgg gtgctgcctg tgctggtatc ggcgcggcgc atcagcgagg aaatggcgaa      1680
     gctgaagcag aagaccgagc agctccagga ccgcatcgcc ggccaggccc ggatcaacca      1740
     ggccaaggtg ttgctgatgc agcgccatgg ctgggacgag cgcgaggcgc accagcacct      1800
     gtcgcgggaa gcgatgaagc ggcgcgagcc gatcctgaag atcgctcagg agttgctggg      1860
     aaacgagccg tccgcctgag cgatccgggc cgaccagaac aataacaaga ggggtatcgt      1920
     catcatgctg ggactggttc tgctgtacgt tggcgcggtg ctgtttctca atgccgtctg      1980
     gttgctgggc aagatcagcg gtcgggaggt ggcggtgatc aacttcctgg tcggcgtgct      2040
     gagcgcctgc gtcgcgttct acctgatctt ttccgcagca gccgggcagg gctcgctgaa      2100
     ggccggagcg ctgaccctgc tattcgcttt tacctatctg tgggtggccg ccaaccagtt      2160
     cctcgag                                                                2167
//

Input files for usage example 2

File: mito.seq

>gi|5819095|ref|NC_001321.1| Balaenoptera physalus mitochondrion, complete genome
GTTAATTACTAATCAGCCCATGATCATAACATAACTGAGGTTTCATACATTTGGTATTTTTTTATTTTTTTTGGGGGGCT
TGCACGGACTCCCCTATGACCCTAAAGGGTCTCGTCGCAGTCAGATAAATTGTAGCTGGGCCTGGATGTATTTGTTATTT
GACTAGCACAACCAACATGTGCAGTTAAATTAATGGTTACAGGACATAGTACTCCACTATTCCCCCCGGGCTCAAAAAAC
TGTATGTCTTAGAGGACCAAACCCCCCTCCTTCCATACAATACTAACCCTCTGCTTAGATATTCACCACCCCCCTAGACA
GGCTCGTCCCTAGATTTAAAAGCCATTTTATTTATAAATCAATACTAAATCTGACACAAGCCCAATAATGAAAATACATG
AACGCCATCCCTATCCAATACGTTGATGTAGCTTAAACACTTACAAAGCAAGACACTGAAAATGTCTAGATGGGTCTAGC
CAACCCCATTGACATTAAAGGTTTGGTCCCAGCCTTTCTATTAGTTCTTAACAGACTTACACATGCAAGTATCCACATCC
CAGTGAGAACGCCCTCTAAATCATAAAGATTAAAAGGAGCGGGTATCAAGCACGCTAGCACTAGCAGCTCACAACGCCTC
GCTTAGCCACGCCCCCACGGGACACAGCAGTGATAAAAATTAAGCTATAAACGAAAGTTCGACTAAGTCATGTTAATTTA
AGGGTTGGTAAACTTCGTGCCAGCCACCGCGGTCATACGATCGACCCAAATTAATAGAAGCACGGCGTAAAGAGTGTTAA
GGAGCCACATGAAATAAAGTCAAACCTTAATTAAGCTGTAAAAAGCCCTAATTAAAATTAAGCCAAACTACGAAAGTGAC
TTTAATATAATCTGATCACACGACAGCTAAGATCCAAACTGGGATTAGATACCCCACTATGCTTAGTCGTAAACCCCAAT
AGTCACAAAACAAGACTATTCGCCAGAGTACTACTAGCAACAGCCTAAAACTCAAAGGACTTGGCGGTGCCTCATACCCA
TCTAGAGGAGCCTGTTCTGTAACCGATAAACCCCGATCAACCTCACCAACCCTTGCTACTTCAGTCTATATACCGCCATC
TTCAGCAAACCCTAAAGGGAGAAAAGTAAGCATAACCATCCTACATAAAAACGTTAGGTCAAGGTGTAACCCATGGGTTG
GGAAGTAATGGGCTACATTTTCTAAGCTAAGAACATCCCCTATACTCACACGAAAGTTTTTATGAAACTTAAAAACTAAA
GGAGGATTTAGTAGTAAATCAAGAGCAGAGTGCTTGATTGAATAAGGCCATGAGGGCACGCACACACCGCCCGTCACCCT
CCTCAAGTACCCCAGCTATAAACCCCAGTTCGTTAACTCAGGCCAAGCAATTATACGAGAGGAGACAAGTCGTAACAAGG
TAAGCATACCGGAAGGTGTGCTTGGACAAAACAAGATATAGCTTAAACAAAGCATGTAGTTTACACCTAGAAGATTCCAC
AGCCCGTGTATATCTTGAACTAGCCCTAGCCCACACCCTCCCCACCTCTACTACCACAAATCAATCAAATAAAACATTTA
CCATCCCTTCAAAGTATAGGAGATAGAAATTTAAATATCAGTGGCGCTATAGAGATAGTACCGTAAGGAAAGATGAAAGA
AAAACCTAAAAGTAATAAAAAGCAAAGCTTACCACTTGTACCTTTTGCATAATGACTTAACTAGTAATAAATTAGCAAAG
AGACCTTAAGTTAAATTACCCGAAACCAGACGAGCTACTTATGAGCAGCACCTAGAACGAACTCATCTATGTGGCAAAAT
AGTGAGAAGACTTATAAGTAGAGGTGAAAAGCCTAACGAGCCTGGTGATAGCTGGTTGTCCCTGAAAAGAATCTCAGTTC
AACATTAAATAATACTAAAAGCCCATGCCAAGCCTTAACGTATATTTAACTGTTAATCTAAAAAGGTACAGCTTTTTAGA
AATGGGTACAACCTTGACTAGAGAGTAAAATCAAACATAAACATAGTTGGCCTAAAAGCAGCCATCAATTAAGAAAGCGT
TCAAGCTCGACAACAAAATAATGTTTTAATTCCAACATTAAGTAAATCAACTCCTAGCCTGACTATTGGACTAATCTATA
CAAATATAGAAGCAATACTGTTAATATGAGTAACAAGAAATTTTTCTCCTAGCACAAGCTTACACCAGTAACTGATAATA
TACTGATAATTAACAGCAAATAAATAAAACCCAACACTAAATTATTTATTAAAATACTGTTAACCCAACACAGGCGTGCA
TTAAGGAAAGATTAAAAAAAGTAAAAGGAACTCGGCAAACACAAACCCCGCCTGTTTACCAAAAACATCACCTCTAGCAT
AACCAGTATTAGAGCACTGCCTGCCCGGTGACTAATCGTTAAACGGCCGCGGTATCCTGACCGTGCAAAGGTAGCATAAT
CACTTGTTCTCTAATTAGGGACTTGTATGAATGGCCACACGAGGGTTTTACTGTCTCTTACTTTTAATCAGTGAAATTGA
CCTCTCCGTGAAGAGGCGGAGATAACAAAATAAGACGAGAAGACCCTATGGAGCTTCAATTAATCAACCCAAAAACCATA
ACCTTAAACCACCAAGGGATAACAAAACCTTATATGGGCTGACAATTTCGGTTGGGGTGACCTCGGAGTACAAAAAACCC
TCCGAGTGATTAAAACTTAGGCCCACTAGCCAAAGTACAATATCACTTATTGATCCAATCCTTTGATCAACGGAACAAGT
TACCCTAGGGATAACAGCGCAATCCTATTCTAGAGTCCATATCGACAATAGGGTTTACGACCTCGATGTTGGATCAGGAC
ATCCTAATGGTGCAGCTGCTATTAAGGGTTCGTTTGTTCAACGATTAAAGTCCTACGTGATCTGAGTTCAGACCGGAGTA
ATCCAGGTCGGTTTCTATCTATTACGCATTTCTCCCAGTACGAAAGGACAAGAGAAATAAGGCCAACTTCAAACAAGCGC
CTTCAAACAATTAATGACCTAGTCTCAACTTAATAATTAAGCGCAAACAAACCTGCCCAAGACCAGGGCCTTGTTGAGGT
GGCAGAGTTCGGTAATTGCATAAAACTTAAACTTTTACACCCAGAGGTTCAAATCCTCTCCCCAACAAAATGTTTATAAT
TAACATTCTAACACTCATTCTCCCCATCCTCCTAGCCGTAGCATTCCTAACGCTAGTAGAACGCAAAATTCTAGGCTATA
TGCAGTTCCGAAAGGGGCCAAACATCGTAGGCCCACATGGCTTACTCCAACCCTTTGCCGATGCAATTAAATTATTCACT
AAAGAACCCCTACGGCCAGCTACATCCTCAACTACTATGTTTATCATTGCACCAGTACTAGCCCTAACCCTGGCCCTCAC
TATATGAAGCCCCCTACCCATACCATACCCCCTCATTAACATAAACCTAGGAGTATTATTCATATTAGCAATATCCAGCC
TAGCCGTCTACTCCATCCTATGATCAGGCTGAGCCTCCAACTCAAAATACGCACTAATTGGAGCCCTACGAGCAGTAGCA
CAAACAATCTCATATGAGGTAACACTAGCCATTATCCTCCTATCAGTACTCCTAATAAACGGCTCCTACACCTTATCAAC
ATTAGCCACAACACAAGAACAACTATGATTACTATTCCCATCATGACCCTTAGCCATAATGTGATTCATCTCCACCCTAG
CAGAAACTAATCGAGCTCCTTTTGATCTAACAGAGGGAGAATCAGAACTCGTATCAGGCTTCAACGTAGAATATGCAGCA
GGCCCTTTCGCCCTATTCTTCCTGGCAGAATACGCCAACATCATTATAATGAATATACTCACAGCCATTTTATTCCTAGG


  [Part of this file has been deleted for brevity]

CATTGTCTTCTGCGCCTTCATCACTAGTCTAGTTCCCGCAATAGTATATCTTCACACAAACCAAGAAACACTCATCTCAA
ACTGACACTGAATCACAATCCAAACCCTCAAACTAACACTTAGCTTTAAAATAGATTACTTTTCACTTATATTTATACCA
GTAGCACTATTCATTACATGATCCATCATAGAATTCTCAATATGATATATGCACTCCGACCCCTACATCAACCAATTTTT
TAAATACTTACTCCTCTTCCTCATCACCATACTAATCCTTGTTACAGCTAACAATCTCTTCCAACTTTTCATCGGATGAG
AAGGAGTAGGAATTATATCCTTCTTACTAATTGGCTGATGATTCGGACGAACAGATGCAAATACAGCCGCCCTCCAAGCA
ATCCTATACAATCGTATCGGAGACATTGGACTCCTTGCATCAATAGCATGATTTCTCTCTAATATAAACACATGAGACCT
AGAACAAATCTTTATACTCAACCAAAACCCCTTAAATTTCCCCCTCATAGGACTCGTACTAGCCGCAGCAGGAAAATCGG
CTCAATTCGGACTCCACCCTTGACTCCCATCAGCAATAGAAGGTCCTACCCCAGTCTCAGCCCTACTCCACTCAAGCACA
ATAGTTGTAGCAGGAATCTTCTTGCTTGTCCGCTTCTACCCATTAATAGAAAATAACAAGCTAATCCAAACAGTAACCCT
CTGCTTAGGCGCTATCACAACTCTATTTACAGCCATCTGTGCCCTCACCCAAAACGACATCAAAAAAATTATTGCTTTCT
CCACCTCCAGCCAGCTAGGCCTAATAATAGTAACAATCGGCCTTAACCAACCTTACCTAGCATTCCTACACATTTGCACA
CACGCCTTCTTTAAAGCTATACTATTCCTATGTTCTGGCTCCATCATCCATAACCTAAACAACGAACAAGATATCCGAAA
AATAGGAGGGCTATTTAAGGCCCTCCCATTCACCACAACCGCCCTTATCATCGGATGTCTTGCACTAACAGGAATGCCAT
TCCTGACCGGATTCTACTCCAAAGATCCCATTATTGAAGCCGCCACTTCGTCTTATACCAACGCCTGAGCCCTATTACTG
ACCTTAATCGCCACCTCCCTTACGGCCGTCTATAGCACCCGCATCATTTTCTTTGCACTACTAGGACAACCCCGCTTCCC
TCCCTCCACAACCATTAACGAAAATAATCCACTGTTAATCAACCCTATCAAACGACTACTCGTCGGAAGTATCTTCGCTG
GCTTCATCCTATCCAACAGTATTCCCCCAATAACTACACCTTTAATAACCATACCCCTGCACTTAAAATTAACCGCCCTT
GCAATAACAACCCTAGGCTTCATCATCGCATTCGAAATTAACCTTGACACACAAAATCTAAAGCACAAGCACCCATCAAA
CTCCTTTAAATTCTCCACCTTACTAGGTTATTTCCCCACAATCATACATCGCCTACCCCCTCACCTTGACCTGTTAATAA
GCCAAAAACTAGCAACTTCCCTACTAGATCTAACTTGACTAGAAACTATTTTACCAAAAACCACAGCCCTTATCCAACTA
AAAGCCTCTACACTAACCTCTAACCAACAAGGCCTCATCAAACTCTACTTCTTATCTTTCCTCATCACCATCACCCTCAG
CATAATCTTATTTAACTACCCCGAGTAATCTCCATAATAATTACAACACTAATAAATAAAGACCAACCCGTAACAATCAC
CAACCAAACACCATAACTATATAATGCCGCAATCCCTGTAGCCTCCTCACTAAAAACCCCAGAACCCCCAGTATCATAAA
CAACCCAGTCCCCTAGTCCATCAAACTCAAACATAATCTTCACCTCCCCACTCTTCAAAGCATAAATCACAATTAAAAAC
TCCACCACCAACCCTAAAACAAATGCTCCTAGTACAACTTTATTAGAAACCCAAACCTCAGGATACTGTTCAGTAGCCAT
AGCTGTTGTATAACCAAATACTACCAGCATTCCCCCCAAATAAATCAAAAACACCATTAACCCCAAAAACGAACCACCAA
AACTCAAAATAACTCCACATCCAACACCACCACCCACAATCAACCCTAAACCCCCATAAATAGGTGAAGGCTTTGAAGAA
ACCCCCACAAAACTAATTACAAAAATAATACTTAAAATGAAAACAATATACATTATCATTATTCTCACATGGACTTCAAC
CATGACCAATGACATGAAAAATCATCGTTGTTATTCAACTACAAGAACACCAATGACCAACATCCGAAAAACACACCCAC
TAATAAAAATCGTCAACGACGCATTCGTCGATCTCCCCACCCCATCAAATATCTCTTCATGATGGAACTTCGGCTCCCTA
CTCGGCCTCTGCTTAATTATACAAATCCTAACAGGCCTATTCCTAGCAATACACTACACACCAGACACAACAACCGCCTT
CTCATCAGTCACACACATCTGCCGAGACGTGAATTACGGCTGAATTATCCGATACCTACATGCAAATGGGGCTTCTATAT
TCTTCATCTGCCTCTACGCTCACATAGGACGAGGCCTATACTACGGCTCCTACGCCTTCCGAGAAACATGAAATATTGGA
GTTATTCTACTATTCACAGTTATAGCCACCGCATTCGTAGGCTACGTCCTGCCCTGAGGACAAATATCATTCTGAGGCGC
AACTGTAATCACTAACCTCCTATCAGCAATCCCATACATTGGTACCACCCTAGTCGAATGAATCTGAGGCGGTTTCTCTG
TAGATAAAGCAACACTAACACGCTTTTTTGCCTTTCACTTTATCCTCCCCTTCATCATCCTAGCATTAGCAATTGTCCAC
CTTATTTTCCTTCACGAAACAGGATCCAACAACCCCACAGGCATCCCATCCGACATAGATAAAATCCCATTCCACCCCTA
CCACACAATTAAAGACATTCTAGGTGCCCTATTACTAATCCTAATCCTACTAATACTAACCCTATTCGCACCCGACCTAC
TTGGAGACCCAGACAACTATACCCCAGCAAACCCACTCAGTACCCCAGCACACATTAAACCAGAATGGTATTTTCTATTC
GCATACGCAATCCTACGATCAATCCCCAACAAACTAGGCGGAGTCTTAGCCCTACTACTCTCAATCCTAATCCTAGCCTT
CATCCCAATACTCCACACATCCAATCAACGAAGCATAATATTTCGACCCTTTAGCCAGTTCTTGTTCTGAGTCCTAGTCG
CAGATCTACTAACCCTAACATGGATCGGCGGCCAACCAGTAGAACACCCCTACATAATTGTAGGCCAACTCGCATCCATC
CTCTATTTCCTCTTAATTCTAGTATTAATACCAGTAACTAGTCTTATCGAGAACAAACTTATAAAATGAAGAGTCTTTGT
AGTATAATTAAATACCCCGGTTTTGTAAACCGGAAAAGGAGACAAGACACACCTCCCTAAGACTCAAGGAAGAAGTATTA
CACTCCACCATCAGCACCCAAAGCTGAAGTTCTACATAAACTATTCCCTGAAAAAGTATATTGTACAATAACCACAGGAC
CACAGTACTATGTCCGTATTGAAAATAACTTGCCTTATTAGATATTATTATGTAACTCGTGCATGCATGTACTTCCACAT
AATTAATAGCGTCTTTCCATGGGTATGAACAGATATACATGCTATGTATAATTGTGCATTCAATTATTTTCACCACGAGC
AGTTGAAGCTCGTATTAAATTTTATTAATTTTACATATTACATAATATGTATTAATAGTACAATAGCGCATGTTCTTATG
CATCCCCAGATCTATTTAAATCAAATGATTCCTATGGCCGCTCCATTAGATCACGAGCTTAGTCAGCATGCCGCGTGAAA
CCAGCAACCCGCTTGGCAGGGATCCCTCTTCTCGCACCGGGCCCATCACTCGTGGGGGTAGCTATTTAATGATCTTTATA
AGACATCTGGTTCTTACTTCAGGACCATATTAACTTAAAATCGCCCACTCGTTCCCCTTAAATAAGACATCTCGATGG

Output file format

Output files for usage example

Graphics File: plotorf.ps

[plotorf results]

Output files for usage example 2

Graphics File: plotorf.ps

[plotorf results]

Data files

None.

Notes

Note that this definition of an ORF would miss those exons in eukaryotic genomic sequences which do not contain a START codon. plotorf is only really useful when dealing with prokaryotic or mRNA eukaryotic sequences.

References

None.

Warnings

ORFs in this program are defined as being regions between START and STOP codons. This definition would miss those exons in eukaryotic genomic sequences which do not contain a START codon. plotorf is therefore only really useful when dealing with prokaryotic or mRNA eukaryotic sequences.

Diagnostic Error Messages

None.

Exit status

It always exits with a status of 0.

Known bugs

None.

See also

Program name Description
backtranambig Back-translate a protein sequence to ambiguous nucleotide sequence
backtranseq Back-translate a protein sequence to a nucleotide sequence
coderet Extract CDS, mRNA and translations from feature tables
getorf Finds and extracts open reading frames (ORFs)
marscan Finds matrix/scaffold recognition (MRS) signatures in DNA sequences
prettyseq Write a nucleotide sequence and its translation to file
remap Display restriction enzyme binding sites in a nucleotide sequence
showorf Display a nucleotide sequence and translation in pretty format
showseq Displays sequences with features in pretty format
sixpack Display a DNA sequence with 6-frame translation and ORFs
syco Draw synonymous codon usage statictic plot for a nucleotide sequence
tcode Identify protein-coding regions using Fickett TESTCODE statistic
transeq Translate nucleic acid sequences
wobble Plot third base position variability in a nucleotide sequence

Author(s)

Alan Bleasby (ajb © ebi.ac.uk)
European Bioinformatics Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge CB10 1SD, UK

History

Written (1999) - Alan Bleasby

Target users

This program is intended to be used by everyone and everything, from naive users to embedded scripts.

Comments

None