shuffleseq

 

Wiki

The master copies of EMBOSS documentation are available at http://emboss.open-bio.org/wiki/Appdocs on the EMBOSS Wiki.

Please help by correcting and extending the Wiki pages.

Function

Shuffles a set of sequences maintaining composition

Description

shuffleseq reads one or more sequences and writes them out again in a random (shuffled) order. The number of shuffles may be specified. Only the order of sequences is changed, no bases or residues are changed.

Usage

Here is a sample session with shuffleseq

This makes two randomised copies of the input sequence:


% shuffleseq -shuffle 2 
Shuffles a set of sequences maintaining composition
Input sequence(s): tembl:L48662
output sequence(s) [l48662.fasta]: 

Go to the input files for this example
Go to the output files for this example

Command line arguments

   Standard (Mandatory) qualifiers:
  [-sequence]          seqall     Sequence(s) filename and optional format, or
                                  reference (input USA)
  [-outseq]            seqoutall  [.] Sequence set(s)
                                  filename and optional format (output USA)

   Additional (Optional) qualifiers: (none)
   Advanced (Unprompted) qualifiers:
   -shuffle            integer    [1] Number of shuffles (Any integer value)

   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin1            integer    Start of each sequence to be used
   -send1              integer    End of each sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -sformat1           string     Input sequence format
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name

   "-outseq" associated qualifiers
   -osformat2          string     Output seq format
   -osextension2       string     File name extension
   -osname2            string     Base file name
   -osdirectory2       string     Output directory
   -osdbname2          string     Database name to add
   -ossingle2          boolean    Separate file for each entry
   -oufo2              string     UFO features
   -offormat2          string     Features format
   -ofname2            string     Features file name
   -ofdirectory2       string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write first file to standard output
   -filter             boolean    Read first file from standard input, write
                                  first file to standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages

Standard (Mandatory) qualifiers Allowed values Default
[-sequence]
(Parameter 1)
Sequence(s) filename and optional format, or reference (input USA) Readable sequence(s) Required
[-outseq]
(Parameter 2)
Sequence set(s) filename and optional format (output USA) Writeable sequence(s) <*>.format
Additional (Optional) qualifiers Allowed values Default
(none)
Advanced (Unprompted) qualifiers Allowed values Default
-shuffle Number of shuffles Any integer value 1

Input file format

shuffleseq reads one or more sequence USAs.

Input files for usage example

'tembl:L48662' is a sequence entry in the example nucleic acid database 'tembl'

Database entry: tembl:L48662

ID   L48662; SV 1; linear; mRNA; STD; MUS; 366 BP.
XX
AC   L48662;
XX
DT   04-NOV-1995 (Rel. 45, Created)
DT   04-MAR-2000 (Rel. 63, Last updated, Version 4)
XX
DE   Mus musculus (cell line C3H/F2-11) chromosome 12 anti-DNA antibody heavy
DE   chain mRNA.
XX
KW   .
XX
OS   Mus musculus (house mouse)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Glires; Rodentia; Sciurognathi; Muroidea;
OC   Muridae; Murinae; Mus.
XX
RN   [1]
RP   1-366
RX   DOI; 10.1002/eji.1830260939.
RX   PUBMED; 8814271.
RA   Wloch M.K., Alexander A.L., Pippen A.M., Pisetsky D.S., Gilkeson G.S.;
RT   "Differences in V kappa gene utilization and VH CDR3 sequence among
RT   anti-DNA from C3H-lpr mice and lupus mice with nephritis";
RL   Eur. J. Immunol. 26(9):2225-2233(1996).
XX
DR   IMGT/LIGM; L48662.
XX
FH   Key             Location/Qualifiers
FH
FT   source          1..366
FT                   /organism="Mus musculus"
FT                   /strain="C3H/HeJ-lpr/lpr"
FT                   /mol_type="mRNA"
FT                   /cell_line="C3H/F2-11"
FT                   /cell_type="hybridoma"
FT                   /tissue_type="spleen"
FT                   /db_xref="taxon:10090"
XX
SQ   Sequence 366 BP; 100 A; 90 C; 85 G; 89 T; 2 other;
     gagnnccagc tgcagcagtc tggacctgag ctggtaaagc ctggggcttc agtgaagatg        60
     tcctgcaagg cttctggata cacattcact agctatgtta tgcactgggt gaatcagaag       120
     cctgggcagg gccttgagtg gattggatat attaatcctt acaatgatgg tactaactac       180
     aatgagaagt tcaaaggcaa ggccacactg acttcagaca aatcctccag cacagcctac       240
     atggagttca gcagcctgac ctctgaggac tctgcggtct attactgtgc aagaaaaact       300
     tcctactata gtaacctata ttactttgac tactggggcc aaggcaccac tctcacagtc       360
     tcctca                                                                  366
//

Output file format

Output files for usage example

File: l48662.fasta

>L48662 L48662.1 Mus musculus (cell line C3H/F2-11) chromosome 12 anti-DNA antibody heavy chain mRNA.
aggtttttatattacaagcatactaagagactcgcgatgatcgcacaattccaaatgtgc
tcatgggtgtagcaagaacctcaaataaaagggcaaccatgagggtaaagtctccgcatg
agcccctgggacgcgagagactttctcccgctagtgggtcgaacctgcagtgtcgataat
tggagttaaaatcgcagcatttacggccatgaattgtgtcgatanacgattcacgcaatc
gttaagatcaggttcattgggntcacaaaccgtaggccccccgttgcctgacgcgtaacg
ttcggatttccgtgacttcatctgactactctgtcacattcttacacgacaagctcaaca
agccgg
>L48662 L48662.1 Mus musculus (cell line C3H/F2-11) chromosome 12 anti-DNA antibody heavy chain mRNA.
gtggatggtatccctaacccatgacttgcgattccattgactaataccgatttcgctatg
cgaataatactgcacaataagcgctgggggttggtttaaanttgcgatgtattatcaggt
gcatcatacgcgtgtcttcaatcgcaggagaatacaaactcagtcccaagcctaaggcgc
gtgagacttcattagggcaacggatactgctaactagttaaactcgcatgtaacaactca
cctgagcggtcgtacatgggcctctcttcccgaagggttgttcgaaaaaagcattgatac
aggccaggcaagcaccacgtgtcagcactacgatggccgttntcaaagtagctcatacag
cctcgc

Each run will produce a different sequence.

Note that these two sequences have the same name.

Data files

None.

Notes

shuffleseq is useful for producing sets of sequences with randomised order which can be used for checking the statistics of sequence similarity searches.

References

None.

Warnings

None.

Diagnostic Error Messages

None.

Exit status

It always exits with status 0.

Known bugs

None.

See also

Program name Description
msbar Mutate a sequence

Author(s)

Michael Schmitz (mschmitz © lbl.gov)
Lawrence Berkeley Labs, USA

History

Target users

This program is intended to be used by everyone and everything, from naive users to embedded scripts.

Comments

None