


The master copies of EMBOSS documentation are available at on the EMBOSS Wiki.

Please help by correcting and extending the Wiki pages.


Calculate approximate local pair-wise alignments of larger sequences


supermatcher calculates an approximate alignment between all the sequences in a first set of sequences and all those from a second stream, typically a database. The alignments are written to a standard alignment file. A combination of a word-match and Smith-Waterman local alignment (dynamic programming) algorithms are used. The alignments will be less acurate than an optimal alignment generated by full dynamic programming, but the program will run faster and use less memory, which means it is suitable for use with larger sequences.


Here is a sample session with supermatcher

% supermatcher @eclac.list tembl:j01636 -word 50  
Calculate approximate local pair-wise alignments of larger sequences
Gap opening penalty [10.0]: 
Gap extension penalty [0.5]: 3.0
Output alignment [j01636.supermatcher]: 

Go to the input files for this example
Go to the output files for this example

Command line arguments

   Standard (Mandatory) qualifiers:
  [-asequence]         seqall     Sequence(s) filename and optional format, or
                                  reference (input USA)
  [-bsequence]         seqset     Sequence set filename and optional format,
                                  or reference (input USA)
   -gapopen            float      [10.0 for any sequence type] Gap opening
                                  penalty (Number from 0.000 to 100.000)
   -gapextend          float      [0.5 for any sequence type] Gap extension
                                  penalty (Number from 0.000 to 10.000)
  [-outfile]           align      [*.supermatcher] Output alignment file name

   Additional (Optional) qualifiers:
   -datafile           matrixf    [EBLOSUM62 for protein, EDNAFULL for DNA]
                                  This is the scoring matrix file used when
                                  comparing sequences. By default it is the
                                  file 'EBLOSUM62' (for proteins) or the file
                                  'EDNAFULL' (for nucleic sequences). These
                                  files are found in the 'data' directory of
                                  the EMBOSS installation.
   -width              integer    [16] Alignment width (Integer 1 or more)
   -wordlen            integer    [6] Word length for initial matching
                                  (Integer 3 or more)
   -errorfile          outfile    [supermatcher.error] Error file to be
                                  written to

   Advanced (Unprompted) qualifiers: (none)
   Associated qualifiers:

   "-asequence" associated qualifiers
   -sbegin1            integer    Start of each sequence to be used
   -send1              integer    End of each sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -sformat1           string     Input sequence format
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name

   "-bsequence" associated qualifiers
   -sbegin2            integer    Start of each sequence to be used
   -send2              integer    End of each sequence to be used
   -sreverse2          boolean    Reverse (if DNA)
   -sask2              boolean    Ask for begin/end/reverse
   -snucleotide2       boolean    Sequence is nucleotide
   -sprotein2          boolean    Sequence is protein
   -slower2            boolean    Make lower case
   -supper2            boolean    Make upper case
   -sformat2           string     Input sequence format
   -sdbname2           string     Database name
   -sid2               string     Entryname
   -ufo2               string     UFO features
   -fformat2           string     Features format
   -fopenfile2         string     Features file name

   "-outfile" associated qualifiers
   -aformat3           string     Alignment format
   -aextension3        string     File name extension
   -adirectory3        string     Output directory
   -aname3             string     Base file name
   -awidth3            integer    Alignment width
   -aaccshow3          boolean    Show accession number in the header
   -adesshow3          boolean    Show description in the header
   -ausashow3          boolean    Show the full USA in the alignment
   -aglobal3           boolean    Show the full sequence in alignment

   "-errorfile" associated qualifiers
   -odirectory         string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write first file to standard output
   -filter             boolean    Read first file from standard input, write
                                  first file to standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages

Standard (Mandatory) qualifiers Allowed values Default
(Parameter 1)
Sequence(s) filename and optional format, or reference (input USA) Readable sequence(s) Required
(Parameter 2)
Sequence set filename and optional format, or reference (input USA) Readable set of sequences Required
-gapopen Gap opening penalty Number from 0.000 to 100.000 10.0 for any sequence type
-gapextend Gap extension penalty Number from 0.000 to 10.000 0.5 for any sequence type
(Parameter 3)
Output alignment file name Alignment output file <*>.supermatcher
Additional (Optional) qualifiers Allowed values Default
-datafile This is the scoring matrix file used when comparing sequences. By default it is the file 'EBLOSUM62' (for proteins) or the file 'EDNAFULL' (for nucleic sequences). These files are found in the 'data' directory of the EMBOSS installation. Comparison matrix file in EMBOSS data path EBLOSUM62 for protein
-width Alignment width Integer 1 or more 16
-wordlen Word length for initial matching Integer 3 or more 6
-errorfile Error file to be written to Output file supermatcher.error
Advanced (Unprompted) qualifiers Allowed values Default

Input file format

supermatcher reads two sequence USAs of the same type. They must both be protein or both be nucleic acid sequences.

Input files for usage example

'tembl:j01636' is a sequence entry in the example nucleic acid database 'tembl'

File: eclac.list

#Formerly ECLAC

#Formerly ECLACA

#Formerly ECLACI

#Formerly ECLACY

#Formerly ECLACZ

Database entry: tembl:j01636

ID   J01636; SV 1; linear; genomic DNA; STD; PRO; 7477 BP.
AC   J01636; J01637; K01483; K01793;
DT   30-NOV-1990 (Rel. 26, Created)
DT   09-SEP-2004 (Rel. 81, Last updated, Version 8)
DE   E.coli lactose operon with lacI, lacZ, lacY and lacA genes.
KW   acetyltransferase; beta-D-galactosidase; galactosidase; lac operon;
KW   lac repressor protein; lacA gene; lacI gene; lactose permease; lacY gene;
KW   lacZ gene; mutagenesis; palindrome; promoter region;
KW   thiogalactoside acetyltransferase.
OS   Escherichia coli
OC   Bacteria; Proteobacteria; Gammaproteobacteria; Enterobacteriales;
OC   Enterobacteriaceae; Escherichia.
RN   [1]
RP   1243-1266
RX   DOI; 10.1073/pnas.70.12.3581.
RX   PUBMED; 4587255.
RA   Gilbert W., Maxam A.;
RT   "The nucleotide sequence of the lac operator";
RL   Proc. Natl. Acad. Sci. U.S.A. 70(12):3581-3584(1973).
RN   [2]
RP   1246-1308
RX   DOI; 10.1073/pnas.70.12.3585.
RX   PUBMED; 4587256.
RA   Maizels N.M.;
RT   "The nucleotide sequence of the lactose messenger ribonucleic acid
RT   transcribed from the UV5 promoter mutant of Escherichia coli";
RL   Proc. Natl. Acad. Sci. U.S.A. 70(12):3585-3589(1973).
RN   [3]
RX   PUBMED; 4598642.
RA   Gilbert W., Maizels N., Maxam A.;
RT   "Sequences of controlling regions of the lactose operon";
RL   Cold Spring Harb. Symp. Quant. Biol. 38:845-855(1974).
RN   [4]
RA   Gilbert W., Gralla J., Majors A.J., Maxam A.;
RT   "Lactose operator sequences and the action of lac repressor";
RL   (in) Sund H., Blauer G. (Eds.);
RL   Walter de Gruyter, New York (1975)
RN   [5]
RP   1146-1282

  [Part of this file has been deleted for brevity]

     cgatttggct acatgacatc aaccatatca gcaaaagtga tacgggtatt atttttgccg      4560
     ctatttctct gttctcgcta ttattccaac cgctgtttgg tctgctttct gacaaactcg      4620
     ggctgcgcaa atacctgctg tggattatta ccggcatgtt agtgatgttt gcgccgttct      4680
     ttatttttat cttcgggcca ctgttacaat acaacatttt agtaggatcg attgttggtg      4740
     gtatttatct aggcttttgt tttaacgccg gtgcgccagc agtagaggca tttattgaga      4800
     aagtcagccg tcgcagtaat ttcgaatttg gtcgcgcgcg gatgtttggc tgtgttggct      4860
     gggcgctgtg tgcctcgatt gtcggcatca tgttcaccat caataatcag tttgttttct      4920
     ggctgggctc tggctgtgca ctcatcctcg ccgttttact ctttttcgcc aaaacggatg      4980
     cgccctcttc tgccacggtt gccaatgcgg taggtgccaa ccattcggca tttagcctta      5040
     agctggcact ggaactgttc agacagccaa aactgtggtt tttgtcactg tatgttattg      5100
     gcgtttcctg cacctacgat gtttttgacc aacagtttgc taatttcttt acttcgttct      5160
     ttgctaccgg tgaacagggt acgcgggtat ttggctacgt aacgacaatg ggcgaattac      5220
     ttaacgcctc gattatgttc tttgcgccac tgatcattaa tcgcatcggt gggaaaaacg      5280
     ccctgctgct ggctggcact attatgtctg tacgtattat tggctcatcg ttcgccacct      5340
     cagcgctgga agtggttatt ctgaaaacgc tgcatatgtt tgaagtaccg ttcctgctgg      5400
     tgggctgctt taaatatatt accagccagt ttgaagtgcg tttttcagcg acgatttatc      5460
     tggtctgttt ctgcttcttt aagcaactgg cgatgatttt tatgtctgta ctggcgggca      5520
     atatgtatga aagcatcggt ttccagggcg cttatctggt gctgggtctg gtggcgctgg      5580
     gcttcacctt aatttccgtg ttcacgctta gcggccccgg cccgctttcc ctgctgcgtc      5640
     gtcaggtgaa tgaagtcgct taagcaatca atgtcggatg cggcgcgacg cttatccgac      5700
     caacatatca taacggagtg atcgcattga acatgccaat gaccgaaaga ataagagcag      5760
     gcaagctatt taccgatatg tgcgaaggct taccggaaaa aagacttcgt gggaaaacgt      5820
     taatgtatga gtttaatcac tcgcatccat cagaagttga aaaaagagaa agcctgatta      5880
     aagaaatgtt tgccacggta ggggaaaacg cctgggtaga accgcctgtc tatttctctt      5940
     acggttccaa catccatata ggccgcaatt tttatgcaaa tttcaattta accattgtcg      6000
     atgactacac ggtaacaatc ggtgataacg tactgattgc acccaacgtt actctttccg      6060
     ttacgggaca ccctgtacac catgaattga gaaaaaacgg cgagatgtac tcttttccga      6120
     taacgattgg caataacgtc tggatcggaa gtcatgtggt tattaatcca ggcgtcacca      6180
     tcggggataa ttctgttatt ggcgcgggta gtatcgtcac aaaagacatt ccaccaaacg      6240
     tcgtggcggc tggcgttcct tgtcgggtta ttcgcgaaat aaacgaccgg gataagcact      6300
     attatttcaa agattataaa gttgaatcgt cagtttaaat tataaaaatt gcctgatacg      6360
     ctgcgcttat caggcctaca agttcagcga tctacattag ccgcatccgg catgaacaaa      6420
     gcgcaggaac aagcgtcgca tcatgcctct ttgacccaca gctgcggaaa acgtactggt      6480
     gcaaaacgca gggttatgat catcagccca acgacgcaca gcgcatgaaa tgcccagtcc      6540
     atcaggtaat tgccgctgat actacgcagc acgccagaaa accacggggc aagcccggcg      6600
     atgataaaac cgattccctg cataaacgcc accagcttgc cagcaatagc cggttgcaca      6660
     gagtgatcga gcgccagcag caaacagagc ggaaacgcgc cgcccagacc taacccacac      6720
     accatcgccc acaataccgg caattgcatc ggcagccaga taaagccgca gaaccccacc      6780
     agttgtaaca ccagcgccag cattaacagt ttgcgccgat cctgatggcg agccatagca      6840
     ggcatcagca aagctcctgc ggcttgccca agcgtcatca atgccagtaa ggaaccgctg      6900
     tactgcgcgc tggcaccaat ctcaatatag aaagcgggta accaggcaat caggctggcg      6960
     taaccgccgt taatcagacc gaagtaaaca cccagcgtcc acgcgcgggg agtgaatacc      7020
     acgcgaaccg gagtggttgt tgtcttgtgg gaagaggcga cctcgcgggc gctttgccac      7080
     caccaggcaa agagcgcaac aacggcaggc agcgccacca ggcgagtgtt tgataccagg      7140
     tttcgctatg ttgaactaac cagggcgtta tggcggcacc aagcccaccg ccgcccatca      7200
     gagccgcgga ccacagcccc atcaccagtg gcgtgcgctg ctgaaaccgc cgtttaatca      7260
     ccgaagcatc accgcctgaa tgatgccgat ccccacccca ccaagcagtg cgctgctaag      7320
     cagcagcgca ctttgcgggt aaagctcacg catcaatgca ccgacggcaa tcagcaacag      7380
     actgatggcg acactgcgac gttcgctgac atgctgatga agccagcttc cggccagcgc      7440
     cagcccgccc atggtaacca ccggcagagc ggtcgac                               7477

Output file format

The output is a standard EMBOSS alignment file.

The results can be output in one of several styles by using the command-line qualifier -aformat xxx, where 'xxx' is replaced by the name of the required format. Some of the alignment formats can cope with an unlimited number of sequences, while others are only for pairs of sequences.

The available multiple alignment format names are: unknown, multiple, simple, fasta, msf, trace, srs

The available pairwise alignment format names are: pair, markx0, markx1, markx2, markx3, markx10, srspair, score

See: for further information on alignment formats.

The output alignment is in simple format by default.

Output files for usage example

File: supermatcher.error

File: j01636.supermatcher

# Program: supermatcher
# Rundate: Tue 15 Jul 2008 12:00:00
# Commandline: supermatcher
#    [-asequence] @../../data/eclac.list
#    [-bsequence] tembl:j01636
#    -wordlen 50
#    -gapextend 3.0
# Align_format: simple
# Report_file: j01636.supermatcher

# Aligned_sequences: 2
# 1: J01636
# 2: J01636
# Matrix: EDNAFULL
# Gap_penalty: 10.0
# Extend_penalty: 3.0
# Length: 7477
# Identity:    7477/7477 (100.0%)
# Similarity:  7477/7477 (100.0%)
# Gaps:           0/7477 ( 0.0%)
# Score: 37385.0

J01636             1 gacaccatcgaatggcgcaaaacctttcgcggtatggcatgatagcgccc     50
J01636             1 gacaccatcgaatggcgcaaaacctttcgcggtatggcatgatagcgccc     50

J01636            51 ggaagagagtcaattcagggtggtgaatgtgaaaccagtaacgttatacg    100
J01636            51 ggaagagagtcaattcagggtggtgaatgtgaaaccagtaacgttatacg    100

J01636           101 atgtcgcagagtatgccggtgtctcttatcagaccgtttcccgcgtggtg    150
J01636           101 atgtcgcagagtatgccggtgtctcttatcagaccgtttcccgcgtggtg    150

J01636           151 aaccaggccagccacgtttctgcgaaaacgcgggaaaaagtggaagcggc    200
J01636           151 aaccaggccagccacgtttctgcgaaaacgcgggaaaaagtggaagcggc    200

J01636           201 gatggcggagctgaattacattcccaaccgcgtggcacaacaactggcgg    250
J01636           201 gatggcggagctgaattacattcccaaccgcgtggcacaacaactggcgg    250

  [Part of this file has been deleted for brevity]

V00296          2501 tgctgattacgaccgctcacgcgtggcagcatcaggggaaaaccttattt   2550
J01636          3787 tgctgattacgaccgctcacgcgtggcagcatcaggggaaaaccttattt   3836

V00296          2551 atcagccggaaaacctaccggattgatggtagtggtcaaatggcgattac   2600
J01636          3837 atcagccggaaaacctaccggattgatggtagtggtcaaatggcgattac   3886

V00296          2601 cgttgatgttgaagtggcgagcgatacaccgcatccggcgcggattggcc   2650
J01636          3887 cgttgatgttgaagtggcgagcgatacaccgcatccggcgcggattggcc   3936

V00296          2651 tgaactgccagctggcgcaggtagcagagcgggtaaactggctcggatta   2700
J01636          3937 tgaactgccagctggcgcaggtagcagagcgggtaaactggctcggatta   3986

V00296          2701 gggccgcaagaaaactatcccgaccgccttactgccgcctgttttgaccg   2750
J01636          3987 gggccgcaagaaaactatcccgaccgccttactgccgcctgttttgaccg   4036

V00296          2751 ctgggatctgccattgtcagacatgtataccccgtacgtcttcccgagcg   2800
J01636          4037 ctgggatctgccattgtcagacatgtataccccgtacgtcttcccgagcg   4086

V00296          2801 aaaacggtctgcgctgcgggacgcgcgaattgaattatggcccacaccag   2850
J01636          4087 aaaacggtctgcgctgcgggacgcgcgaattgaattatggcccacaccag   4136

V00296          2851 tggcgcggcgacttccagttcaacatcagccgctacagtcaacagcaact   2900
J01636          4137 tggcgcggcgacttccagttcaacatcagccgctacagtcaacagcaact   4186

V00296          2901 gatggaaaccagccatcgccatctgctgcacgcggaagaaggcacatggc   2950
J01636          4187 gatggaaaccagccatcgccatctgctgcacgcggaagaaggcacatggc   4236

V00296          2951 tgaatatcgacggtttccatatggggattggtggcgacgactcctggagc   3000
J01636          4237 tgaatatcgacggtttccatatggggattggtggcgacgactcctggagc   4286

V00296          3001 ccgtcagtatcggcggaattccagctgagcgccggtcgctaccattacca   3050
J01636          4287 ccgtcagtatcggcggaattccagctgagcgccggtcgctaccattacca   4336

V00296          3051 gttggtctggtgtcaaaaataataataa   3078
J01636          4337 gttggtctggtgtcaaaaataataataa   4364


The file 'supermatcher.error' will contain any errors that occured during the program. This may be that wordmatch could not find any matches hence no suitable start point is found for the smith-waterman calculation.

Data files

For protein sequences EBLOSUM62 is used for the substitution matrix. For nucleotide sequence, EDNAMAT is used. Others can be specified.

EMBOSS data files are distributed with the application and stored in the standard EMBOSS data directory, which is defined by the EMBOSS environment variable EMBOSS_DATA.

To see the available EMBOSS data files, run:

% embossdata -showall

To fetch one of the data files (for example 'Exxx.dat') into your current directory for you to inspect or modify, run:

% embossdata -fetch -file Exxx.dat

Users can provide their own data files in their own directories. Project specific files can be put in the current directory, or for tidier directory listings in a subdirectory called ".embossdata". Files for all EMBOSS runs can be put in the user's home directory, or again in a subdirectory called ".embossdata".

The directories are searched in the following order:


supermatcher generates approximate local alignments for large sequences. The alignments are approximate because as a first step, all the sequence word matches between two sequences are found. By identifying the highest scoring, non-overlapping matches a set of approximate local alignments are calculated for two sequences. These give the centre points for more acurate Smith-Waterman type alignments in a region of width specified by the user. The use of Smith-Waterman in narrow regions means the alignment overall will be rough, but due to the memory saving much larger sequences can be aligned.

For the Swmith-Waterman alignment, the gap open and extension penalties and substition matrix may be specified, the later by default is EBLOSUM62 for protein sequences and EDNAMAT for nucleotide sequence.

For the word-match alignment, the word length may be specified. The time required for alignment depends very much on word size. A small word size (e.g. 4) may take a very long time even for short sequences. Much larger word sizes (e.g. 30) will give a very quick result. The default of 16 should give reasonably fast alignments.




supermatcher performs a Smith & Waterman alignment (albeit in a narrow best-matching regions identified by simple word-match) and therefore can use huge amounts of memory if the sequences are large. The longer the sequences and the wider the specified alignment width, the more memory will be used. If the program terminates due to lack of memory you can try running the UNIX command limit to see if your stack or memory usage have been limited and if so, run unlimit, (e.g.: % unlimit stacksize).

Because the alignment is made within a narrow area each side of the 'best' diagonal identified by word-matching, if there are sufficient indels between the two sequences, then the path of the Smith & Waterman alignment can wander outside of this area. Making the width larger can avoid this problem, but you then use more memory.

Diagnostic Error Messages


Exit status

It always exits with a status of 0.

Known bugs


See also

Program name Description
matcher Waterman-Eggert local alignment of two sequences
seqmatchall All-against-all word comparison of a sequence set
water Smith-Waterman local alignment of sequences
wordfinder Match large sequences against one or more other sequences
wordmatch Finds regions of identity (exact matches) of two sequences


Ian Longden (il ©
Sanger Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SA, UK.


Target users

This program is intended to be used by everyone and everything, from naive users to embedded scripts.

