makenucseq

 

Wiki

The master copies of EMBOSS documentation are available at http://emboss.open-bio.org/wiki/Appdocs on the EMBOSS Wiki.

Please help by correcting and extending the Wiki pages.

Function

Create random nucleotide sequences

Description

makenucseq writes an output file with a set of random nucleotide sequences. The sequence composition is defined from reading a codon usage file: the sequences are created with triplet frequencies matching those given in the file, with the end trimmed to be in the correct reading frame. The number of sequences to create and length of each sequence is specified. Optionally, a user-defined string may be inserted into each output sequence at a specified position

Algorithm

Usage

Here is a sample session with makenucseq


% makenucseq 
Create random nucleotide sequences
Codon usage file (optional): 
Number of sequences created [100]: 
Length of each sequence [100]: 
nucleotide output sequence(s) [makeseq.fasta]: 

Go to the output files for this example

Example 2

Providing a codon usage file specifies the sequence composition. This Pseudomonas aeruginosa file specifies a high GC content.


% makenucseq 
Create random nucleotide sequences
Codon usage file (optional): Epseae.cut
Number of sequences created [100]: 
Length of each sequence [100]: 
nucleotide output sequence(s) [makeseq.fasta]: 

Go to the output files for this example

Command line arguments

Create random nucleotide sequences
Version: EMBOSS:6.2.0

   Standard (Mandatory) qualifiers (* if not always prompted):
   -codonfile          codon      Optional codon usage file. Nucleotide
                                  sequences will be created as triplets
                                  matching the frequencies in the file, with
                                  the end trimmed to be in the correct reading
                                  frame.
   -amount             integer    [100] Number of sequences created (Integer 1
                                  or more)
   -length             integer    [100] Length of each sequence (Integer 1 or
                                  more)
*  -insert             string     String that is inserted into sequence (Any
                                  string)
*  -start              integer    [1] Start point of inserted sequence
                                  (Integer 1 or more)
  [-outseq]            seqoutall  [.] Nucleotide sequence
                                  set(s) filename and optional format (output
                                  USA)

   Additional (Optional) qualifiers:
   -useinsert          toggle     [N] Do you want to make an insert

   Advanced (Unprompted) qualifiers: (none)
   Associated qualifiers:

   "-codonfile" associated qualifiers
   -format             string     Data format

   "-outseq" associated qualifiers
   -osformat1          string     Output seq format
   -osextension1       string     File name extension
   -osname1            string     Base file name
   -osdirectory1       string     Output directory
   -osdbname1          string     Database name to add
   -ossingle1          boolean    Separate file for each entry
   -oufo1              string     UFO features
   -offormat1          string     Features format
   -ofname1            string     Features file name
   -ofdirectory1       string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write first file to standard output
   -filter             boolean    Read first file from standard input, write
                                  first file to standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options and exit. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages
   -version            boolean    Report version number and exit

Qualifier Type Description Allowed values Default
Standard (Mandatory) qualifiers
-codonfile codon Optional codon usage file. Nucleotide sequences will be created as triplets matching the frequencies in the file, with the end trimmed to be in the correct reading frame. Codon usage file in EMBOSS data path  
-amount integer Number of sequences created Integer 1 or more 100
-length integer Length of each sequence Integer 1 or more 100
-insert string String that is inserted into sequence Any string  
-start integer Start point of inserted sequence Integer 1 or more 1
[-outseq]
(Parameter 1)
seqoutall Nucleotide sequence set(s) filename and optional format (output USA) Writeable sequence(s) <*>.format
Additional (Optional) qualifiers
-useinsert toggle Do you want to make an insert Toggle value Yes/No No
Advanced (Unprompted) qualifiers
(none)
Associated qualifiers
"-codonfile" associated codon qualifiers
-format string Data format Any string  
"-outseq" associated seqoutall qualifiers
-osformat1
-osformat_outseq
string Output seq format Any string  
-osextension1
-osextension_outseq
string File name extension Any string  
-osname1
-osname_outseq
string Base file name Any string  
-osdirectory1
-osdirectory_outseq
string Output directory Any string  
-osdbname1
-osdbname_outseq
string Database name to add Any string  
-ossingle1
-ossingle_outseq
boolean Separate file for each entry Boolean value Yes/No N
-oufo1
-oufo_outseq
string UFO features Any string  
-offormat1
-offormat_outseq
string Features format Any string  
-ofname1
-ofname_outseq
string Features file name Any string  
-ofdirectory1
-ofdirectory_outseq
string Output directory Any string  
General qualifiers
-auto boolean Turn off prompts Boolean value Yes/No N
-stdout boolean Write first file to standard output Boolean value Yes/No N
-filter boolean Read first file from standard input, write first file to standard output Boolean value Yes/No N
-options boolean Prompt for standard and additional values Boolean value Yes/No N
-debug boolean Write debug output to program.dbg Boolean value Yes/No N
-verbose boolean Report some/full command line options Boolean value Yes/No Y
-help boolean Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose Boolean value Yes/No N
-warning boolean Report warnings Boolean value Yes/No Y
-error boolean Report errors Boolean value Yes/No Y
-fatal boolean Report fatal errors Boolean value Yes/No Y
-die boolean Report dying program messages Boolean value Yes/No Y
-version boolean Report version number and exit Boolean value Yes/No N

Input file format

makenucseq reads any normal sequence USAs.

Output file format

makenucseq writes a sequence file with the number of sequences requested.

Output files for usage example

File: makeseq.fasta

>EMBOSS_001
ggtccgaggggtagcttgatcgcctcttttgggaacgcaagcgtggccggtatgataaaa
taaaatgcgctccgctctggtaagacggacggtcgcccta
>EMBOSS_002
tttcaatccattaggagatccttccgggcttactcttttttggtaggaatacagacgaat
gtgttgttgacactacaagtacgaactgtgatcgcaccct
>EMBOSS_003
aacggctgttagaccgcatcattttggcaggaaccttgggtcggttcatctcttgggtat
gacagcacagggaggtttgagagctgcctcccggattttg
>EMBOSS_004
atcgaagagacgcattcctatagtatcaatccttgacgtcggcatggttcggatcttacg
cgaagccctacgactccctaccggtattgtatcgttctag
>EMBOSS_005
agagttcgtctacacatgggcacccttactacttgagtgcttaccaaaagtacgatccac
gaaacgtcgagcactggcatgcacacgctctccgacgtat
>EMBOSS_006
caatcctcattgcttacacggccacaacaggaagtgcctcaagctgtagagcataggcat
gttctcaagatcgcgttaacagccattgctggagaatggc
>EMBOSS_007
actcggagttcaaccgccgctgtgggctgagctatccctaatgacccgcgcgtagagtgt
taaaatctttcgacagtcacctgcacatcgttgtcttctg
>EMBOSS_008
cgagggtcattctaaatttgagggtaatgctcgcgccatgcgacttgtcgggaaagcggc
cctttatgcgttgccggtcggcattgcccaaccctagtga
>EMBOSS_009
gttatcacgtccaattaggtgggccacaatacgtcggcagaatcaagtgcataacggaga
ggtcactaggacgttactgtcattccctgccccgctatgt
>EMBOSS_010
tatgtttctcgtgctcagcttagaccggagagctccacccaataggccgcacacaagggg
tctttaggatacccccccccttattaccccacagcaacag
>EMBOSS_011
agacgcgccgctcgtagtatgttacctcccttacctgaggacctgcgtggatggcggcaa
cgtgcctcaaagcccgcagcgaatggaaagcaggttggtg
>EMBOSS_012
accctcgcgctgtcgtgtatatttctagcgatgagctagttcgtgcggccatggttctgg
atgcatggctatggtttgttcagacggaatagtccgggac
>EMBOSS_013
accctgacagctcttaccctctatggacggacagggcatgaccgtgcatgacctggcaga
gaacggcttcatattagggagcagcagaatcgtgtatcgt
>EMBOSS_014
tcctgccgggaattagagacaaaaagattgtgaccttcacagcctcctactttcttttgt
tagtatggggcttgacactatacactgggacaatttagaa
>EMBOSS_015
ccgtagcaaggccacagttacgaaggtcatgttcccacccacagcgttgttcccttttac
cgacccacgcctagaatttctcgaagaacagaaaccaccc
>EMBOSS_016
cttctcccgtaagaaccttcgtccaacatccaatcaatcacggtgggtacgaggtatacc
tatctgtcacgaaatcctaagacatttctgcaaacagggg
>EMBOSS_017
cagtagttgatgcacgtaacatttactcattggacaacagcacagtagctcccatcacat


  [Part of this file has been deleted for brevity]

>EMBOSS_084
ttaccatttaaacatgtccagatacggacaggtcgcactgtccttgggccacttttctgt
tacgcgcgtgagcttatgatgacgaatcgcgggaagggat
>EMBOSS_085
cctcactctctcagaccccgaatcctaagtgatcaatacctctacgtcttggttttgccg
ctgatatcatgatatacatgagtctagcacggtctcctac
>EMBOSS_086
aggcagggtatagtgctctagagtacaccccttgcgtgaaatcggcgtcctggtggtcga
ttaccctcaagcacttttcctcagttcggggggtcacgat
>EMBOSS_087
ataagtctaccaatgaaacgatcgcgaatcggacgccactcgccagggtattcgcgcttc
acattatatatagtccggaagcacgactctccatttggtt
>EMBOSS_088
tctatccgtgcctcccacgggtcagatatatgctctggacgtagtggtgccgcatctgtg
tacatgactaaagctacgactttttcgcgtagccaatcca
>EMBOSS_089
ccgccgtaactttcccgggtagggggctaccgacgataatctagcgtttgatagcgtctg
gcgcatgtgtcatagggtgctggtgtccttgggcagtaca
>EMBOSS_090
acgaatccccctttccacacgacaaaaacgagaccggtagctttgggcgagacgtacgct
gactaagcaatcgaagcccttcaagtacgctgccagtcaa
>EMBOSS_091
gtgacctgagacttgagctactaatgcacttgtacgagggcttacaaaaagaacggatca
aagcaagccctcgggatgtgtgacccaggcgtttgccgtg
>EMBOSS_092
accgttcgagagatctcacaactagcacatatacgccagaggtagtcacacagattaaga
tggtgcgacagctcgcgcaaccacacggggatgacacgta
>EMBOSS_093
aaccctaaccgagggtttgtggctaacatcagccccactgtgcccgcaacgtcccaaatt
gactctatctcgttccaacactttaaatgcttatgtatat
>EMBOSS_094
gtctggtacgttcagcgcgattagccgggcgctccggaccggatgtcctaccaggtacac
ctatccagtaccacggcgcggtgtagccgtacctcaaagc
>EMBOSS_095
taggttggatagacgacggtctgtcaaggctcaccaagggttaatctgcctctgataagt
gttggactatgggggcaacgcctcgaccagttgaacctgt
>EMBOSS_096
gaccgtggtgcattctagtacgtatgagcatccaaacatgcgccacatgtaccagggtga
tgctggagtcgctgtggaacaagagcgttctaccccctcg
>EMBOSS_097
atcataggcccaagtcggatcatgtttatccgagtttaacaagttctgcagtggcagaaa
agtgtctttttagcagctcccctattgccacggctgctac
>EMBOSS_098
taactagcagtttcgttatttaagagacttatgcgttaataaaatcttgttatggggcca
ccagtccttattaatccgtaaggagacgagccgcctggag
>EMBOSS_099
tcgggatgggaactgtagtaagtaaatacagcagaacaagaccagctgtaggaccgcaag
taattcgcatggggccttgctctctacaatcacggcagcc
>EMBOSS_100
taaatcggcatggtggagttatctttaagattgcaccatatgtggccgagccggaaaagc
ttatggggtgccaggtttagcctcttgttacatagtgacg

Output files for usage example 2

File: makeseq.fasta

>EMBOSS_001
gggcgtctgggcgccgtcacggtcggccgctacctcgacccggcgttctccgtcaacttc
gcgcggcagggcttcatctgactgctgttcggcgtgcgcg
>EMBOSS_002
gacgccggcgcgaccgagcggcaccgcttcgtccgaggaggcggcggcttcaccctcgtg
gccttcgacgacagcaccctggaagagaaggactacccgg
>EMBOSS_003
cgcgccttcgccgccggtggcctgcactggggggttctgaccgagggcaggatcggccgc
aggggcccggtgctgatcgtcgcccaccacctgaccctgc
>EMBOSS_004
ctgcagaaggacttaatgcacaccctgttcaagcggggtaaacccgagctgggcatcctg
ttcggccagcgcgtgccggccttgtcgaccggctacggcc
>EMBOSS_005
ttcctctcctacctgcgctacctgaacgtgccagaagagtccagcggcgaacgcagcgcc
ggcaccgacctgcgctcccccttcctgcggctgtgaggtg
>EMBOSS_006
gccgacgcgtgcgaccataccgaccgcctggacatccgcagcaccatgttccccctgcgc
gagctcatccgcgcggaggcgatcatctacgacgagggcg
>EMBOSS_007
ccgcacctgcgcctgctgaccgtgaacgccattccggccaattggatcacctcgtgcctg
ctggtgggcatcaagggcgggaccgaggccggcttcctgg
>EMBOSS_008
ggcggcctggcgcctcgctatcgtgccaactgcatcttcgcgctgctgcggcggccgctg
gacctgccggatgcggaggtcgccgagagtgacccggttg
>EMBOSS_009
aagggcccgctgctctcagggaacgtcacgcgcgcgtacgtcggcgcggaagccgccgcg
gttgtggccctgtcgctgctgcgggactatgccgtagaga
>EMBOSS_010
gtcgacggtaaggccgtggcgacctcgttccaggccctggaacttgagggctccacctcg
ggaaaagagctgatgatccgttacgtaagcggccgccgtc
>EMBOSS_011
cggcgcgcggcactcccggtctcgttcgccccgcggaactggcacctgtggacgatccgc
caagtcgagaagtaaggccacgccctcacgggccgcaaga
>EMBOSS_012
tatcaggcccagctcgagcaacaccatccgtgcagctgactcggccgtaattggcagcat
ctttcgatcttggccccgaagggtaagcgcttgctggcgg
>EMBOSS_013
ctgatctacacccatgcccagaccctagtgggcccgcacaaggcgcaccaacgttgaact
ggctgagaccagtgggaaccgaaacgctacgggggcctcc
>EMBOSS_014
gccatggccaccaacgaagatggctgcgccatccgcagcctccagcaggacgcgggcgag
acggaccaaccgctgcacggcgacgtgatgaacattttcg
>EMBOSS_015
cgccagagctcgcgcggcgaggcgacccagggcgcgctgcagtggggacaggtcaacgcg
ccgctggacttcgcgagcaacctgcagatgctcattgagc
>EMBOSS_016
ctgggcgcgtcgctggagggcgaccacggcgtggcgcagaaagctaatgccagtgatggt
gtcgatacccgactgcctgcgatgtgggccgacaagccga
>EMBOSS_017
ctcggcttcagccccacccctgcgagcctggacgtgggcgctaagttcggcctctcgggc


  [Part of this file has been deleted for brevity]

>EMBOSS_084
ctgcgccacctgcgcggggaaaacggcatcgccacgatgtcggagatcggtgagtacgcg
agcaagcggggcatggaagccgaggccttcctgagcacac
>EMBOSS_085
cactactacatccgcctgctgctgcaggccaccatcttcctggtcagccgcacgcgcacc
ggcgtattgattatctgtcgctttgagccggtgtttaaga
>EMBOSS_086
actgccgagatcaagcagtacggtgcgccgccggcaccgggtgacgccctcggcgaccgc
gactgccgcggcgccgtgggtctgctgagccgccaatccg
>EMBOSS_087
cggaggaacaccagcgacatctatgaatggttcctgcagctggccaccgtgtcgctgatc
gccgaggagctcatcaacttccgtaccggccagaatgccc
>EMBOSS_088
gggatcctggacgaagcggccgccttctcgaaggagaacagaagctactatccggacggc
ctgtacacccacgtgtacaagcgcaacgagcaatggcgga
>EMBOSS_089
gcgctgctgcgcgcccgctcgaaatgggatcgctacgagaacatcgccaagtacctgatg
aaggaggaggcagacgccgaccaggaacaggtcaccctcc
>EMBOSS_090
ccgatcgacggctacggtaccaacctgtacgccccgatgccgcatctgggcaggagcgac
cccccgcgcgccctcgggcccccaattcaacagatcgctc
>EMBOSS_091
gcgaaccactcgaacgttctggtgatggcgcataccaattacaaccgcgacgccggccgt
atcccctaccaaccgagtcgacacaccggcgaggccggcg
>EMBOSS_092
tccatcgagaaggccatcccgccggtccgtatcaaggggctggccggccgcccgtgcctc
ctaggccgggcgagcctagcgaccatcgcctatgacgcca
>EMBOSS_093
attctgcccgacgaagacctctacgagatccgcggcttcatgcacaaggccgggcatgcg
gacccgggcgacgaacatatcaccgtgccgctcaggcacc
>EMBOSS_094
cgcgtctacccgcgtcaggacgcgctgaccgccgtcctggtgaaccgccttgacaatttc
ctgaccctgggcaaccagatgctggagctcaacgtccaat
>EMBOSS_095
gacctgatggagcatttcagctcgtacctgtccctggccggcggcctcttaggcataaag
cgcaccgccccgctatcccgtatcgggacggccctggata
>EMBOSS_096
tgactggtcagctacggccgcttcctgctcatcgccccgctgggtctgcggacggagttc
gaacagctgtccctgggcggcgagccgggcccggccgacc
>EMBOSS_097
gcccatcggggtcgctgcgtgaatccgtgcgttggagcgcggcgcgcctgcgaaaacctg
ccgctgtcgccggcggtgctgctggaggtggtccgcagcg
>EMBOSS_098
cgcgcccctatggaacgcctgttcgcggcgttcgcgatcgccatcctggggatcatggtg
ttcgccatgctggacatcagcatcgaagagcgtttcccgc
>EMBOSS_099
gcgaagtgccgcaccttcgtgggcagctacacgattcagagtttggacacccgggagacg
aagcagaccgtcatcgatgaggagaccaagaccaaattga
>EMBOSS_100
ctcggccggcaactgcggcgcgaaccgatgccgccctacgcggccctgcgttagatggac
ctcgcccccgcccgcgaccgagtcgcgctcgacacggtcg

Data files

Notes

None.

References

None.

Warnings

None.

Diagnostic Error Messages

None.

Exit status

It always exits with status 0.

Known bugs

None.

See also

Program name Description
aligncopy Reads and writes alignments
aligncopypair Reads and writes pairs from alignments
biosed Replace or delete sequence sections
codcopy Copy and reformat a codon usage table
cutseq Removes a section from a sequence
degapseq Removes non-alphabetic (e.g. gap) characters from sequences
descseq Alter the name or description of a sequence
entret Retrieves sequence entries from flatfile databases and files
extractalign Extract regions from a sequence alignment
extractfeat Extract features from sequence(s)
extractseq Extract regions from a sequence
featcopy Reads and writes a feature table
featreport Reads and writes a feature table
listor Write a list file of the logical OR of two sets of sequences
makeprotseq Create random protein sequences
maskambignuc Masks all ambiguity characters in nucleotide sequences with N
maskambigprot Masks all ambiguity characters in protein sequences with X
maskfeat Write a sequence with masked features
maskseq Write a sequence with masked regions
newseq Create a sequence file from a typed-in sequence
nohtml Remove mark-up (e.g. HTML tags) from an ASCII text file
noreturn Remove carriage return from ASCII files
nospace Remove all whitespace from an ASCII text file
notab Replace tabs with spaces in an ASCII text file
notseq Write to file a subset of an input stream of sequences
nthseq Write to file a single sequence from an input stream of sequences
nthseqset Reads and writes (returns) one set of sequences from many
pasteseq Insert one sequence into another
revseq Reverse and complement a nucleotide sequence
seqret Reads and writes (returns) sequences
seqretsetall Reads and writes (returns) many sets of sequences
seqretsplit Reads sequences and writes them to individual files
sizeseq Sort sequences by size
skipredundant Remove redundant sequences from an input set
skipseq Reads and writes (returns) sequences, skipping first few
splitsource Split sequence(s) into original source sequences
splitter Split sequence(s) into smaller sequences
trimest Remove poly-A tails from nucleotide sequences
trimseq Remove unwanted characters from start and end of sequence(s)
trimspace Remove extra whitespace from an ASCII text file
union Concatenate multiple sequences into a single sequence
vectorstrip Removes vectors from the ends of nucleotide sequence(s)
yank Add a sequence reference (a full USA) to a list file

Author(s)

This application was contributed by Henrikki Almusa, Medicel, Helsinki, Finland

History

Target users

This program is intended to be used by everyone and everything, from naive users to embedded scripts.

Comments

None