


The master copies of EMBOSS documentation are available at http://emboss.open-bio.org/wiki/Appdocs on the EMBOSS Wiki.

Please help by correcting and extending the Wiki pages.


Finds inverted repeats in nucleotide sequences


einverted finds inverted repeats (stem loops) in nucleotide sequences. It identifies regions of local alignment of the input sequence and its reverse complement that exceed a threshold score. The alignments may include a proportion of mismatches and gaps, which correspond to bulges in the stem loop. One or more sequences are read and a file with the sequence(s) (without gap characters) of the inverted repeat regions is written. It can find multiple inverted repeats in a sequence. Only non-overlapping matches are reported.


einverted uses dynamic programming and thus is guaranteed to find optimal, local alignments between the sequence and its reverse complement. Matched bases contribute positively to the score whereas gaps and mismatches are penalised. The score for a local alignment is the sum of the values of each match, minus penalties for mismatches and gap insertion. Any region whose score exceeds the threshold is reported. The gap penalty, match score and mismatch score, and the threshold score for reporting regions, are all user-specified.


Here is a sample session with einverted

% einverted tembl:d00596 
Finds inverted repeats in nucleotide sequences
Gap penalty [12]: 
Minimum score threshold [50]: 
Match score [3]: 
Mismatch score [-4]: 
Sanger Centre program inverted output file [d00596.inv]: 
File for sequence of regions of inverted repeats. [d00596.fasta]: 

Go to the input files for this example
Go to the output files for this example

Command line arguments

Finds inverted repeats in nucleotide sequences
Version: EMBOSS:6.3.0

   Standard (Mandatory) qualifiers:
  [-sequence]          seqall     Nucleotide sequence(s) filename and optional
                                  format, or reference (input USA)
   -gap                integer    [12] Gap penalty (Any integer value)
   -threshold          integer    [50] Minimum score threshold (Any integer
   -match              integer    [3] Match score (Any integer value)
   -mismatch           integer    [-4] Mismatch score (Any integer value)
  [-outfile]           outfile    [*.einverted] Sanger Centre program inverted
                                  output file
  [-outseq]            seqout     [.] The sequence of the
                                  inverted repeat regions without gap

   Additional (Optional) qualifiers:
   -maxrepeat          integer    [2000] Maximum separation between the start
                                  of repeat and the end of the inverted repeat
                                  (the default is 2000 bases). (Any integer

   Advanced (Unprompted) qualifiers: (none)
   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin1            integer    Start of each sequence to be used
   -send1              integer    End of each sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -sformat1           string     Input sequence format
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name

   "-outfile" associated qualifiers
   -odirectory2        string     Output directory

   "-outseq" associated qualifiers
   -osformat3          string     Output seq format
   -osextension3       string     File name extension
   -osname3            string     Base file name
   -osdirectory3       string     Output directory
   -osdbname3          string     Database name to add
   -ossingle3          boolean    Separate file for each entry
   -oufo3              string     UFO features
   -offormat3          string     Features format
   -ofname3            string     Features file name
   -ofdirectory3       string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write first file to standard output
   -filter             boolean    Read first file from standard input, write
                                  first file to standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options and exit. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages
   -version            boolean    Report version number and exit

Qualifier Type Description Allowed values Default
Standard (Mandatory) qualifiers
(Parameter 1)
seqall Nucleotide sequence(s) filename and optional format, or reference (input USA) Readable sequence(s) Required
-gap integer Gap penalty Any integer value 12
-threshold integer Minimum score threshold Any integer value 50
-match integer Match score Any integer value 3
-mismatch integer Mismatch score Any integer value -4
(Parameter 2)
outfile Sanger Centre program inverted output file Output file <*>.einverted
(Parameter 3)
seqout The sequence of the inverted repeat regions without gap characters. Writeable sequence <*>.format
Additional (Optional) qualifiers
-maxrepeat integer Maximum separation between the start of repeat and the end of the inverted repeat (the default is 2000 bases). Any integer value 2000
Advanced (Unprompted) qualifiers
Associated qualifiers
"-sequence" associated seqall qualifiers
integer Start of each sequence to be used Any integer value 0
integer End of each sequence to be used Any integer value 0
boolean Reverse (if DNA) Boolean value Yes/No N
boolean Ask for begin/end/reverse Boolean value Yes/No N
boolean Sequence is nucleotide Boolean value Yes/No N
boolean Sequence is protein Boolean value Yes/No N
boolean Make lower case Boolean value Yes/No N
boolean Make upper case Boolean value Yes/No N
string Input sequence format Any string  
string Database name Any string  
string Entryname Any string  
string UFO features Any string  
string Features format Any string  
string Features file name Any string  
"-outfile" associated outfile qualifiers
string Output directory Any string  
"-outseq" associated seqout qualifiers
string Output seq format Any string  
string File name extension Any string  
string Base file name Any string  
string Output directory Any string  
string Database name to add Any string  
boolean Separate file for each entry Boolean value Yes/No N
string UFO features Any string  
string Features format Any string  
string Features file name Any string  
string Output directory Any string  
General qualifiers
-auto boolean Turn off prompts Boolean value Yes/No N
-stdout boolean Write first file to standard output Boolean value Yes/No N
-filter boolean Read first file from standard input, write first file to standard output Boolean value Yes/No N
-options boolean Prompt for standard and additional values Boolean value Yes/No N
-debug boolean Write debug output to program.dbg Boolean value Yes/No N
-verbose boolean Report some/full command line options Boolean value Yes/No Y
-help boolean Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose Boolean value Yes/No N
-warning boolean Report warnings Boolean value Yes/No Y
-error boolean Report errors Boolean value Yes/No Y
-fatal boolean Report fatal errors Boolean value Yes/No Y
-die boolean Report dying program messages Boolean value Yes/No Y
-version boolean Report version number and exit Boolean value Yes/No N

Input file format

The input for einverted is a nucleotide sequence

Input files for usage example

'tembl:d00596' is a sequence entry in the example nucleic acid database 'tembl'

Database entry: tembl:d00596

ID   D00596; SV 1; linear; genomic DNA; STD; HUM; 18596 BP.
AC   D00596;
DT   17-JUL-1991 (Rel. 28, Created)
DT   07-DEC-2007 (Rel. 94, Last updated, Version 6)
DE   Homo sapiens gene for thymidylate synthase, complete cds.
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-18596
RX   PUBMED; 2243092.
RA   Kaneda S., Nalbantoglu J., Takeishi K., Shimizu K., Gotoh O., Seno T.,
RA   Ayusawa D.;
RT   "Structural and functional analysis of the human thymidylate synthase
RT   gene";
RL   J. Biol. Chem. 265(33):20277-20284(1990).
DR   GDB; 163670.
DR   GDB; 182340.
CC   These data kindly submitted in computer readable form by:
CC   Sumiko Kaneda
CC   National Institute of Genetics
CC   1111 Yata
CC   Mishima 411
CC   Japan
FH   Key             Location/Qualifiers
FT   source          1..18596
FT                   /organism="Homo sapiens"
FT                   /chromosome="18"
FT                   /map="18p11.32"
FT                   /mol_type="genomic DNA"
FT                   /clone="lambdaHTS-1 and lambdaHTS-3"
FT                   /db_xref="taxon:9606"
FT   repeat_region   1..148
FT                   /rpt_family="Alu"
FT   repeat_region   202..477
FT                   /rpt_family="Alu"
FT   prim_transcript 822..16246
FT                   /note="thymidylate synthase mRNA and introns"

  [Part of this file has been deleted for brevity]

     ttttgttttt agcttcagcg agaacccaga cctttcccaa agctcaggat tcttcgaaaa     15660
     gttgagaaaa ttgatgactt caaagctgaa gactttcaga ttgaagggta caatccgcat     15720
     ccaactatta aaatggaaat ggctgtttag ggtgctttca aaggagctcg aaggatattg     15780
     tcagtcttta ggggttgggc tggatgccga ggtaaaagtt ctttttgctc taaaagaaaa     15840
     aggaactagg tcaaaaatct gtccgtgacc tatcagttat taatttttaa ggatgttgcc     15900
     actggcaaat gtaactgtgc cagttctttc cataataaaa ggctttgagt taactcactg     15960
     agggtatctg acaatgctga ggttatgaac aaagtgagga gaatgaaatg tatgtgctct     16020
     tagcaaaaac atgtatgtgc atttcaatcc cacgtactta taaagaaggt tggtgaattt     16080
     cacaagctat ttttggaata tttttagaat attttaagaa tttcacaagc tattccctca     16140
     aatctgaggg agctgagtaa caccatcgat catgatgtag agtgtggtta tgaactttaa     16200
     agttatagtt gttttatatg ttgctataat aaagaagtgt tctgcattcg tccacgcttt     16260
     gttcattctg tactgccact tatctgctca gttccttcct aaaatagatt aaagaactct     16320
     ccttaagtaa acatgtgctg tattctggtt tggatgctac ttaaaagagt atattttaga     16380
     aataatagtg aatatatttt gccctatttt tctcatttta actgcatctt atcctcaaaa     16440
     tataatgacc atttaggata gagttttttt tttttttttt taaactttta taaccttaaa     16500
     gggttatttt aaaataatct atggactacc attttgccct cattagcttc agcatggtgt     16560
     gacttctcta ataatatgct tagattaagc aaggaaaaga tgcaaaacca cttcggggtt     16620
     aatcagtgaa atatttttcc cttcgttgca taccagatac ccccggtgtt gcacgactat     16680
     ttttattctg ctaatttatg acaagtgtta aacagaacaa ggaattattc caacaagtta     16740
     tgcaacatgt tgcttatttt caaattacag tttaatgtct aggtgccagc ccttgatata     16800
     gctatttttg taagaacatc ctcctggact ttgggttagt taaatctaaa cttatttaag     16860
     gattaagtag gataacgtgc attgatttgc taaaagaatc aagtaataat tacttagctg     16920
     attcctgagg gtggtatgac ttctagctga actcatcttg atcggtagga ttttttaaat     16980
     ccatttttgt aaaactattt ccaagaaatt ttaagccctt tcacttcaga aagaaaaaag     17040
     ttgttggggc tgagcactta attttcttga gcaggaagga gtttcttcca aacttcacca     17100
     tctggagact ggtgtttctt tacagattcc tccttcattt ctgttgagta gccgggatcc     17160
     tatcaaagac caaaaaaatg agtcctgtta acaaccacct ggaacaaaaa cagattttat     17220
     gcatttatgc tgctccaaga aatgctttta cgtctaagcc agaggcaatt aattaatttt     17280
     tttttttttg acatggagtc actgtccgtt gcccaggctg cagtgcagtg gcgcaatctt     17340
     ggctcactgc aacctccacc tcccaggttc aagtgattct cctgcctcag cctcccatgt     17400
     agctgggatc acaggcacct gccaccatgc ccggctaatt ttttgtattt tttgtagaga     17460
     cagggtttca ccatgttggc caggctggtc tcaaacacct gacctcaaat gatccacctg     17520
     cctcagcctc ccaaagtgtt gggattacag gcgtaagcca ccatgcccag ccctgaatta     17580
     atatttttaa aataagtttg gagactgttg gaaataatag ggcagaggaa catattttac     17640
     tggctacttg ccagagttag ttaactcatc aaactctttg ataatagttt gacctctgtt     17700
     ggtgaaaatg agccatgatc tcttgaacat gatcagaata aatgccccag ccacacaatt     17760
     gtagtccaaa ctttttaggt cactaacttg ctagatggtg ccaggttttt ttgcacaagg     17820
     agtgcaaatg ttaagatctc cactagtgag gaaaggctag tattacagaa gccttgtcag     17880
     aggcaattga acctccaagc cctggccctc aggcctgagg attttgatac agacaaactg     17940
     aagaaccgtt tgttagtgga tattgcaaac aaacaggagt caaagcttgg tgctccacag     18000
     tctagttcac gagacaggcg tggcagtggc tggcagcatc tcttctcaca ggggccctca     18060
     ggcacagctt accttgggag gcatgtagga agcccgctgg atcatcacgg gatacttgaa     18120
     atgctcatgc aggtggtcaa catactcaca caccctagga ggagggaatc agatcggggc     18180
     aatgatgcct gaagtcagat tattcacgtg gtgctaactt aaagcagaag gagcgagtac     18240
     cactcaattg acagtgttgg ccaaggctta gctgtgttac catgcgtttc taggcaagtc     18300
     cctaaacctc tgtgcctcag gtccttttct tctaaaatat agcaatgtga ggtggggact     18360
     ttgatgacat gaacacacga agtccctctg agaggttttg tggtgccctt taaaagggat     18420
     caattcagac tctgtaaata tccagaatta tttgggttcc tctggtcaaa agtcagatga     18480
     atagattaaa atcaccacat tttgtgatct atttttcaag aagcgtttgt attttttcat     18540
     atggctgcag cagctgccag gggcttgggg tttttttggc aggtagggtt gggagg         18596

Output file format

Output files for usage example

File: d00596.fasta


File: d00596.inv

D00596: Score 236: 108/130 ( 83%) matches, 0 gaps
      13 gctacgcgagaggctgaggcagcagaattacttgaacccaggaggcggaggttgcagtgagccgagatcgcgccactgcactccagcctgggtgagagagcgagactctgtctcaaaaaaaaaaaaaaaa 142     
         |||||  | ||||||||||||| |||||| ||||||||  |||||| |||||||||||||||| |||||   ||| || ||||||||||||| || ||||| ||||| |  |  ||||||||||||||||
     328 cgatgaaccctccgactccgtcttcttaacgaacttggaccctccgtctccaacgtcactcggttctaggctggtaacatgaggtcggacccgctgtctcgttctgacagggtttttttttttttttttt 199     

D00596: Score 164: 128/174 ( 73%) matches, 3 gaps
   12128 agaggatttttttttttttttttttttttgagacagagttttgctctgttgcccaggctggaatgcaacggcgtgatcttggctcactgtaacctctgcctcc-tgggttcgagtgattctcctgcctcagcctc-caagtagctgggattaca-gcatgtgccaccatgcctggct 12301   
         ||||  || || || || || |||||    |  ||| || |  |||||||||||||| |||| ||||| ||||||||| || ||||||  | ||||    ||| ||||||| | |||| |||  ||||  |||||   ||| | ||| |||||| |  || |||||||  |||||||
   12749 tctcaaaacaacaacaacaacaaaaatttataagtcccagagtgagacaacgggtcctacctcacgttaccgcactagtactgagtgatgtcggagtttaaggcacccaagtttactaggagagcggaaccggagacctcaacaaccttaatgtccacactcggtggtgtggaccga 12573   

D00596: Score 80: 44/51 ( 86%) matches, 2 gaps
   12246 ctcctgcctcag-cctccaagtagctgggattaca-gcatgtgccaccatgcc 12296   
         |||||| ||||| | |||||   |||||||||||| ||||| |||||||| ||
   13938 gaggacagagtcagaaggtttcacgaccctaatgtccgtactcggtggtatgg 13886   

D00596: Score 99: 53/65 ( 81%) matches, 1 gaps
   13884 tgggtatggtggctcatgcctgtaatcccagcactttggaagactgagacaggagcaattgcttga 13949   
         ||||| |||||||   ||||||||||||||||    ||| || ||||| ||| || ||||||||||
   14692 acccacaccaccgtacacggacattagggtcgatggaccctccgactccgtcttc-ttaacgaact 14628   

Data files



The original "inverted" program (from which einverted was derived) was used to annotate the nematode genome. Excluding overlapping repeats saved problems with simple repeat sequences in this genome.

einverted will find optimal alignments but is slower than heuristic methods such as BLAST.

Sometimes you can find repeats using the program palindrome that you can't find with einverted using the default parameters.

This is not due to a problem with either program. It is simply because some of the shortest repeats that you find with palindrome's default parameter values are below einverted's default cutoff score - you should decrease the 'Minimum score threshold' to see them.

For example, when palindrome is run with 'em:x65921', it finds the repeat:

64    aaaactaaggc    74
98    ttttgattccg    88

einverted will not report this as its score is 33 (11 bases scoring 3 each, no mismatches or gaps) which is below the default score cutoff of 50.

If einverted is run as:

% einverted em:x65921 -threshold 30

then it will find it:

Score 33: 11/11 (100%) matches, 0 gaps
      64 aaaactaaggc 74      
      98 ttttgattccg 88      

Anything can be considered to be a repeat if you set the score threshold low enough!

einverted does not report overlapping matches.


Some useful references on inverted repeats:

  1. Pearson CE, Zorbas H, Price GB, Zannis-Hadjopoulos M Inverted repeats, stem-loops, and cruciforms: significance for initiation of DNA replication. J Cell Biochem 1996 Oct;63(1):1-22
  2. Waldman AS, Tran H, Goldsmith EC, Resnick MA. q Long inverted repeats are an at-risk motif for recombination in mammalian cells. Genetics. 1999 Dec;153(4):1873-83. PMID: 10581292; UI: 20050682
  3. Jacobsen SE Gene silencing: Maintaining methylation patterns. Curr Biol 1999 Aug 26;9(16):R617-9
  4. Lewis S, Akgun E, Jasin M. Palindromic DNA and genome stability. Further studies. Ann N Y Acad Sci. 1999 May 18;870:45-57. PMID: 10415472; UI: 99343961
  5. Dai X, Greizerstein MB, Nadas-Chinni K, Rothman-Denes LB Supercoil-induced extrusion of a regulatory DNA hairpin. Proc Natl Acad Sci U S A 1997 Mar 18;94(6):2174-9



Diagnostic Error Messages


Exit status

It always exits with a status of 0.

Known bugs


See also

Program name Description
equicktandem Finds tandem repeats in nucleotide sequences
etandem Finds tandem repeats in a nucleotide sequence
palindrome Finds inverted repeats in nucleotide sequence(s)
palindrome also looks for inverted repeats but is much faster and less sensitive, as it looks for near-perfect repeats.


This program was originally written by Richard Durbin
Sanger Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SA, UK.

Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author.

This application was modified for inclusion in EMBOSS by Peter Rice
European Bioinformatics Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge CB10 1SD, UK

Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author.


Written (1999) - Peter Rice

Target users

This program is intended to be used by everyone and everything, from naive users to embedded scripts.

