extractfeat

 

Wiki

The master copies of EMBOSS documentation are available at http://emboss.open-bio.org/wiki/Appdocs on the EMBOSS Wiki.

Please help by correcting and extending the Wiki pages.

Function

Extract features from sequence(s)

Description

extractfeat is a simple utility for extracting regions of a sequence that are annotated as being a specified type of feature. It reads one or more sequences, and writes out the sequences and features of interest to an output sequence file. 'joined' features can either be extracted as individual sequences, or as a single concatenated sequence if the -join qualifier is used. If the feature is annotated as being in the reverse sense of a nucleic acid sequence, then that feature's sub-sequence is reverse-complemented before it is written.

There are many options control exactly what parts of the feature table are given in the output file. In addition, it is often useful to have contextual information about a feature. There are options to specify a number of positions before and/or after the specified feature which will be reported in the output file.

Usage

Here is a sample session with extractfeat

To write out the exons of a sequence:


% extractfeat tembl:x65921 -type exon 
Extract features from sequence(s)
output sequence [x65921.fasta]: 

Go to the input files for this example
Go to the output files for this example

Example 2

To write out the exons with 10 extra bases at the start and end so that you can inspect the splice sites:


% extractfeat tembl:x65921 -type exon -before 10 -after 10 
Extract features from sequence(s)
output sequence [x65921.fasta]: 

Go to the output files for this example

Example 3

To write out the 10 bases around the start of all 'exon' features in the tembl database:


% extractfeat "tembl:*"  -type exon -before 5 -after -5 
Extract features from sequence(s)
output sequence [em498477.fasta]: 

Go to the output files for this example

Example 4

To extract the CDS region with the exons joined into one sequence:


% extractfeat tembl:x65921 -type CDS -join 
Extract features from sequence(s)
output sequence [x65921.fasta]: 

Go to the output files for this example

Example 5

To write out the 7 residues around all phosphorylated serine residues


% extractfeat "tsw:*" -type MOD_RES -value "phosphoserine*" -before 3 -after -4 
Extract features from sequence(s)
output sequence [cru4_arath.fasta]: 

Go to the output files for this example

Command line arguments

Extract features from sequence(s)
Version: EMBOSS:6.5.0.0

   Standard (Mandatory) qualifiers:
  [-sequence]          seqall     Sequence(s) filename and optional format, or
                                  reference (input USA)
  [-outseq]            seqout     [.] Sequence filename and
                                  optional format (output USA)

   Additional (Optional) qualifiers:
   -before             integer    [0] If this value is greater than 0 then
                                  that number of bases or residues before the
                                  feature are included in the extracted
                                  sequence. This allows you to get the context
                                  of the feature. If this value is negative
                                  then the start of the extracted sequence
                                  will be this number of bases/residues before
                                  the end of the feature. So a value of '10'
                                  will start the extraction 10 bases/residues
                                  before the start of the sequence, and a
                                  value of '-10' will start the extraction 10
                                  bases/residues before the end of the
                                  feature. The output sequence will be padded
                                  with 'N' or 'X' characters if the sequence
                                  starts after the required start of the
                                  extraction. (Any integer value)
   -after              integer    [0] If this value is greater than 0 then
                                  that number of bases or residues after the
                                  feature are included in the extracted
                                  sequence. This allows you to get the context
                                  of the feature. If this value is negative
                                  then the end of the extracted sequence will
                                  be this number of bases/residues after the
                                  start of the feature. So a value of '10'
                                  will end the extraction 10 bases/residues
                                  after the end of the sequence, and a value
                                  of '-10' will end the extraction 10
                                  bases/residues after the start of the
                                  feature. The output sequence will be padded
                                  with 'N' or 'X' characters if the sequence
                                  ends before the required end of the
                                  extraction. (Any integer value)
   -source             string     [*] By default any feature source in the
                                  feature table is shown. You can set this to
                                  match any feature source you wish to show.
                                  The source name is usually either the name
                                  of the program that detected the feature or
                                  it is the feature table (eg: EMBL) that the
                                  feature came from.
                                  The source may be wildcarded by using '*'.
                                  If you wish to show more than one source,
                                  separate their names with the character '|',
                                  eg:
                                  gene* | embl (Any string)
   -type               string     [*] By default every feature in the feature
                                  table is extracted. You can set this to be
                                  any feature type you wish to extract.
                                  See http://www.ebi.ac.uk/embl/WebFeat/ for a
                                  list of the EMBL feature types and see the
                                  Uniprot user manual in
                                  http://www.uniprot.org/manual/sequence_annotation
                                  for a list of the Uniprot feature types.
                                  The type may be wildcarded by using '*'.
                                  If you wish to extract more than one type,
                                  separate their names with the character '|',
                                  eg:
                                  *UTR | intron (Any string)
   -sense              integer    [0 - any sense, 1 - forward sense, -1 -
                                  reverse sense] By default any feature type
                                  in the feature table is extracted. You can
                                  set this to match any feature sense you
                                  wish. 0 - any sense, 1 - forward sense, -1 -
                                  reverse sense (Any integer value)
   -minscore           float      [0.0] Minimum score of feature to extract
                                  (see also maxscore) (Any numeric value)
   -maxscore           float      [0.0] Maximum score of feature to extract.
                                  If both minscore and maxscore are zero (the
                                  default), then any score is ignored (Any
                                  numeric value)
   -tag                string     [*] Tags are the types of extra values that
                                  a feature may have. For example in the EMBL
                                  feature table, a 'CDS' type of feature may
                                  have the tags '/codon', '/codon_start',
                                  '/db_xref', '/EC_number', '/evidence',
                                  '/exception', '/function', '/gene',
                                  '/label', '/map', '/note', '/number',
                                  '/partial', '/product', '/protein_id',
                                  '/pseudo', '/standard_name', '/translation',
                                  '/transl_except', '/transl_table', or
                                  '/usedin'. Some of these tags also have
                                  values, for example '/gene' can have the
                                  value of the gene name.
                                  By default any feature tag in the feature
                                  table is extracted. You can set this to
                                  match any feature tag you wish to show.
                                  The tag may be wildcarded by using '*'.
                                  If you wish to extract more than one tag,
                                  separate their names with the character '|',
                                  eg:
                                  gene | label (Any string)
   -value              string     [*] Tag values are the values associated
                                  with a feature tag. Tags are the types of
                                  extra values that a feature may have. For
                                  example in the EMBL feature table, a 'CDS'
                                  type of feature may have the tags '/codon',
                                  '/codon_start', '/db_xref', '/EC_number',
                                  '/evidence', '/exception', '/function',
                                  '/gene', '/label', '/map', '/note',
                                  '/number', '/partial', '/product',
                                  '/protein_id', '/pseudo', '/standard_name',
                                  '/translation', '/transl_except',
                                  '/transl_table', or '/usedin'. Only some of
                                  these tags can have values, for example
                                  '/gene' can have the value of the gene name.
                                  By default any feature tag value in the
                                  feature table is shown. You can set this to
                                  match any feature tag value you wish to
                                  show.
                                  The tag value may be wildcarded by using
                                  '*'.
                                  If you wish to show more than one tag value,
                                  separate their names with a space or the
                                  character '|', eg:
                                  pax* | 10 (Any string)
   -join               boolean    [N] Some features, such as CDS (coding
                                  sequence) and mRNA are composed of introns
                                  concatenated together. There may be other
                                  forms of 'joined' sequence, depending on the
                                  feature table. If this option is set TRUE,
                                  then any group of these features will be
                                  output as a single sequence. If the 'before'
                                  and 'after' qualifiers have been set, then
                                  only the sequence before the first feature
                                  and after the last feature are added.
   -featinname         boolean    [N] To aid you in identifying the type of
                                  feature that has been output, the type of
                                  feature is added to the start of the
                                  description of the output sequence.
                                  Sometimes the description of a sequence is
                                  lost in subsequent processing of the
                                  sequences file, so it is useful for the type
                                  to be a part of the sequence ID name. If
                                  you set this to be TRUE then the name is
                                  added to the ID name of the output sequence.
   -describe           string     To aid you in identifying some further
                                  properties of a feature that has been
                                  output, this lets you specify one or more
                                  tag names that should be added to the output
                                  sequence Description text, together with
                                  their values (if any). For example, if this
                                  is set to be 'gene', then if any output
                                  feature has the tag (for example)
                                  '/gene=BRCA1' associated with it, then the
                                  text '(gene=BRCA1)' will be added to the
                                  Description line. Tags are the types of
                                  extra values that a feature may have. For
                                  example in the EMBL feature table, a 'CDS'
                                  type of feature may have the tags '/codon',
                                  '/codon_start', '/db_xref', '/EC_number',
                                  '/evidence', '/exception', '/function',
                                  '/gene', '/label', '/map', '/note',
                                  '/number', '/partial', '/product',
                                  '/protein_id', '/pseudo', '/standard_name',
                                  '/translation', '/transl_except',
                                  '/transl_table', or '/usedin'. Some of these
                                  tags also have values, for example '/gene'
                                  can have the value of the gene name.
                                  By default no feature tag is displayed. You
                                  can set this to match any feature tag you
                                  wish to show.
                                  The tag may be wildcarded by using '*'.
                                  If you wish to extract more than one tag,
                                  separate their names with the character '|',
                                  eg:
                                  gene | label (Any string)

   Advanced (Unprompted) qualifiers: (none)
   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin1            integer    Start of each sequence to be used
   -send1              integer    End of each sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -scircular1         boolean    Sequence is circular
   -sformat1           string     Input sequence format
   -iquery1            string     Input query fields or ID list
   -ioffset1           integer    Input start position offset
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name

   "-outseq" associated qualifiers
   -osformat2          string     Output seq format
   -osextension2       string     File name extension
   -osname2            string     Base file name
   -osdirectory2       string     Output directory
   -osdbname2          string     Database name to add
   -ossingle2          boolean    Separate file for each entry
   -oufo2              string     UFO features
   -offormat2          string     Features format
   -ofname2            string     Features file name
   -ofdirectory2       string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write first file to standard output
   -filter             boolean    Read first file from standard input, write
                                  first file to standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options and exit. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages
   -version            boolean    Report version number and exit

Qualifier Type Description Allowed values Default
Standard (Mandatory) qualifiers
[-sequence]
(Parameter 1)
seqall Sequence(s) filename and optional format, or reference (input USA) Readable sequence(s) Required
[-outseq]
(Parameter 2)
seqout Sequence filename and optional format (output USA) Writeable sequence <*>.format
Additional (Optional) qualifiers
-before integer If this value is greater than 0 then that number of bases or residues before the feature are included in the extracted sequence. This allows you to get the context of the feature. If this value is negative then the start of the extracted sequence will be this number of bases/residues before the end of the feature. So a value of '10' will start the extraction 10 bases/residues before the start of the sequence, and a value of '-10' will start the extraction 10 bases/residues before the end of the feature. The output sequence will be padded with 'N' or 'X' characters if the sequence starts after the required start of the extraction. Any integer value 0
-after integer If this value is greater than 0 then that number of bases or residues after the feature are included in the extracted sequence. This allows you to get the context of the feature. If this value is negative then the end of the extracted sequence will be this number of bases/residues after the start of the feature. So a value of '10' will end the extraction 10 bases/residues after the end of the sequence, and a value of '-10' will end the extraction 10 bases/residues after the start of the feature. The output sequence will be padded with 'N' or 'X' characters if the sequence ends before the required end of the extraction. Any integer value 0
-source string By default any feature source in the feature table is shown. You can set this to match any feature source you wish to show. The source name is usually either the name of the program that detected the feature or it is the feature table (eg: EMBL) that the feature came from. The source may be wildcarded by using '*'. If you wish to show more than one source, separate their names with the character '|', eg: gene* | embl Any string *
-type string By default every feature in the feature table is extracted. You can set this to be any feature type you wish to extract. See http://www.ebi.ac.uk/embl/WebFeat/ for a list of the EMBL feature types and see the Uniprot user manual in http://www.uniprot.org/manual/sequence_annotation for a list of the Uniprot feature types. The type may be wildcarded by using '*'. If you wish to extract more than one type, separate their names with the character '|', eg: *UTR | intron Any string *
-sense integer By default any feature type in the feature table is extracted. You can set this to match any feature sense you wish. 0 - any sense, 1 - forward sense, -1 - reverse sense Any integer value 0 - any sense, 1 - forward sense, -1 - reverse sense
-minscore float Minimum score of feature to extract (see also maxscore) Any numeric value 0.0
-maxscore float Maximum score of feature to extract. If both minscore and maxscore are zero (the default), then any score is ignored Any numeric value 0.0
-tag string Tags are the types of extra values that a feature may have. For example in the EMBL feature table, a 'CDS' type of feature may have the tags '/codon', '/codon_start', '/db_xref', '/EC_number', '/evidence', '/exception', '/function', '/gene', '/label', '/map', '/note', '/number', '/partial', '/product', '/protein_id', '/pseudo', '/standard_name', '/translation', '/transl_except', '/transl_table', or '/usedin'. Some of these tags also have values, for example '/gene' can have the value of the gene name. By default any feature tag in the feature table is extracted. You can set this to match any feature tag you wish to show. The tag may be wildcarded by using '*'. If you wish to extract more than one tag, separate their names with the character '|', eg: gene | label Any string *
-value string Tag values are the values associated with a feature tag. Tags are the types of extra values that a feature may have. For example in the EMBL feature table, a 'CDS' type of feature may have the tags '/codon', '/codon_start', '/db_xref', '/EC_number', '/evidence', '/exception', '/function', '/gene', '/label', '/map', '/note', '/number', '/partial', '/product', '/protein_id', '/pseudo', '/standard_name', '/translation', '/transl_except', '/transl_table', or '/usedin'. Only some of these tags can have values, for example '/gene' can have the value of the gene name. By default any feature tag value in the feature table is shown. You can set this to match any feature tag value you wish to show. The tag value may be wildcarded by using '*'. If you wish to show more than one tag value, separate their names with a space or the character '|', eg: pax* | 10 Any string *
-join boolean Some features, such as CDS (coding sequence) and mRNA are composed of introns concatenated together. There may be other forms of 'joined' sequence, depending on the feature table. If this option is set TRUE, then any group of these features will be output as a single sequence. If the 'before' and 'after' qualifiers have been set, then only the sequence before the first feature and after the last feature are added. Boolean value Yes/No No
-featinname boolean To aid you in identifying the type of feature that has been output, the type of feature is added to the start of the description of the output sequence. Sometimes the description of a sequence is lost in subsequent processing of the sequences file, so it is useful for the type to be a part of the sequence ID name. If you set this to be TRUE then the name is added to the ID name of the output sequence. Boolean value Yes/No No
-describe string To aid you in identifying some further properties of a feature that has been output, this lets you specify one or more tag names that should be added to the output sequence Description text, together with their values (if any). For example, if this is set to be 'gene', then if any output feature has the tag (for example) '/gene=BRCA1' associated with it, then the text '(gene=BRCA1)' will be added to the Description line. Tags are the types of extra values that a feature may have. For example in the EMBL feature table, a 'CDS' type of feature may have the tags '/codon', '/codon_start', '/db_xref', '/EC_number', '/evidence', '/exception', '/function', '/gene', '/label', '/map', '/note', '/number', '/partial', '/product', '/protein_id', '/pseudo', '/standard_name', '/translation', '/transl_except', '/transl_table', or '/usedin'. Some of these tags also have values, for example '/gene' can have the value of the gene name. By default no feature tag is displayed. You can set this to match any feature tag you wish to show. The tag may be wildcarded by using '*'. If you wish to extract more than one tag, separate their names with the character '|', eg: gene | label Any string  
Advanced (Unprompted) qualifiers
(none)
Associated qualifiers
"-sequence" associated seqall qualifiers
-sbegin1
-sbegin_sequence
integer Start of each sequence to be used Any integer value 0
-send1
-send_sequence
integer End of each sequence to be used Any integer value 0
-sreverse1
-sreverse_sequence
boolean Reverse (if DNA) Boolean value Yes/No N
-sask1
-sask_sequence
boolean Ask for begin/end/reverse Boolean value Yes/No N
-snucleotide1
-snucleotide_sequence
boolean Sequence is nucleotide Boolean value Yes/No N
-sprotein1
-sprotein_sequence
boolean Sequence is protein Boolean value Yes/No N
-slower1
-slower_sequence
boolean Make lower case Boolean value Yes/No N
-supper1
-supper_sequence
boolean Make upper case Boolean value Yes/No N
-scircular1
-scircular_sequence
boolean Sequence is circular Boolean value Yes/No N
-sformat1
-sformat_sequence
string Input sequence format Any string  
-iquery1
-iquery_sequence
string Input query fields or ID list Any string  
-ioffset1
-ioffset_sequence
integer Input start position offset Any integer value 0
-sdbname1
-sdbname_sequence
string Database name Any string  
-sid1
-sid_sequence
string Entryname Any string  
-ufo1
-ufo_sequence
string UFO features Any string  
-fformat1
-fformat_sequence
string Features format Any string  
-fopenfile1
-fopenfile_sequence
string Features file name Any string  
"-outseq" associated seqout qualifiers
-osformat2
-osformat_outseq
string Output seq format Any string  
-osextension2
-osextension_outseq
string File name extension Any string  
-osname2
-osname_outseq
string Base file name Any string  
-osdirectory2
-osdirectory_outseq
string Output directory Any string  
-osdbname2
-osdbname_outseq
string Database name to add Any string  
-ossingle2
-ossingle_outseq
boolean Separate file for each entry Boolean value Yes/No N
-oufo2
-oufo_outseq
string UFO features Any string  
-offormat2
-offormat_outseq
string Features format Any string  
-ofname2
-ofname_outseq
string Features file name Any string  
-ofdirectory2
-ofdirectory_outseq
string Output directory Any string  
General qualifiers
-auto boolean Turn off prompts Boolean value Yes/No N
-stdout boolean Write first file to standard output Boolean value Yes/No N
-filter boolean Read first file from standard input, write first file to standard output Boolean value Yes/No N
-options boolean Prompt for standard and additional values Boolean value Yes/No N
-debug boolean Write debug output to program.dbg Boolean value Yes/No N
-verbose boolean Report some/full command line options Boolean value Yes/No Y
-help boolean Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose Boolean value Yes/No N
-warning boolean Report warnings Boolean value Yes/No Y
-error boolean Report errors Boolean value Yes/No Y
-fatal boolean Report fatal errors Boolean value Yes/No Y
-die boolean Report dying program messages Boolean value Yes/No Y
-version boolean Report version number and exit Boolean value Yes/No N

Input file format

extractfeat reads normal sequences with features.

Feature tables in Swissprot, EMBL, GFF, etc. format can be added using '-ufo featurefile' on the command line.

Input files for usage example

'tembl:x65921' is a sequence entry in the example nucleic acid database 'tembl'

Database entry: tembl:x65921

ID   X65921; SV 1; linear; genomic DNA; STD; HUM; 2016 BP.
XX
AC   X65921; S45242;
XX
DT   13-MAY-1992 (Rel. 31, Created)
DT   14-NOV-2006 (Rel. 89, Last updated, Version 7)
XX
DE   H.sapiens fau 1 gene
XX
KW   fau 1 gene.
XX
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
XX
RN   [1]
RP   1-2016
RA   Kas K.;
RT   ;
RL   Submitted (29-APR-1992) to the INSDC.
RL   K. Kas, University of Antwerp, Dept of Biochemistry T3.22,
RL   Universiteitsplein 1, 2610 Wilrijk, BELGIUM
XX
RN   [2]
RP   1-2016
RX   DOI; 10.1016/0006-291X(92)91286-Y.
RX   PUBMED; 1326960.
RA   Kas K., Michiels L., Merregaert J.;
RT   "Genomic structure and expression of the human fau gene: encoding the
RT   ribosomal protein S30 fused to a ubiquitin-like protein";
RL   Biochem. Biophys. Res. Commun. 187(2):927-933(1992).
XX
DR   Ensembl-Gn; ENSG00000149806; Homo_sapiens.
DR   Ensembl-Tr; ENST00000279259; Homo_sapiens.
DR   Ensembl-Tr; ENST00000434372; Homo_sapiens.
DR   Ensembl-Tr; ENST00000525297; Homo_sapiens.
DR   Ensembl-Tr; ENST00000526555; Homo_sapiens.
DR   Ensembl-Tr; ENST00000527548; Homo_sapiens.
DR   Ensembl-Tr; ENST00000529259; Homo_sapiens.
DR   Ensembl-Tr; ENST00000529639; Homo_sapiens.
DR   Ensembl-Tr; ENST00000531743; Homo_sapiens.
DR   GDB; 191789.
DR   GDB; 191790.
DR   GDB; 354872.
DR   GDB; 4590236.
XX
FH   Key             Location/Qualifiers
FH
FT   source          1..2016


  [Part of this file has been deleted for brevity]

FT                   RAKRRMQYNRRFVNVVPTFGKKKGPNANS"
FT   intron          857..950
FT                   /number=2
FT   exon            951..1095
FT                   /number=3
FT   intron          1096..1556
FT                   /number=3
FT   exon            1557..1612
FT                   /number=4
FT   intron          1613..1786
FT                   /number=4
FT   exon            1787..>1912
FT                   /number=5
FT   polyA_signal    1938..1943
XX
SQ   Sequence 2016 BP; 421 A; 562 C; 538 G; 495 T; 0 other;
     ctaccatttt ccctctcgat tctatatgta cactcgggac aagttctcct gatcgaaaac        60
     ggcaaaacta aggccccaag taggaatgcc ttagttttcg gggttaacaa tgattaacac       120
     tgagcctcac acccacgcga tgccctcagc tcctcgctca gcgctctcac caacagccgt       180
     agcccgcagc cccgctggac accggttctc catccccgca gcgtagcccg gaacatggta       240
     gctgccatct ttacctgcta cgccagcctt ctgtgcgcgc aactgtctgg tcccgccccg       300
     tcctgcgcga gctgctgccc aggcaggttc gccggtgcga gcgtaaaggg gcggagctag       360
     gactgccttg ggcggtacaa atagcaggga accgcgcggt cgctcagcag tgacgtgaca       420
     cgcagcccac ggtctgtact gacgcgccct cgcttcttcc tctttctcga ctccatcttc       480
     gcggtagctg ggaccgccgt tcaggtaaga atggggcctt ggctggatcc gaagggcttg       540
     tagcaggttg gctgcggggt cagaaggcgc ggggggaacc gaagaacggg gcctgctccg       600
     tggccctgct ccagtcccta tccgaactcc ttgggaggca ctggccttcc gcacgtgagc       660
     cgccgcgacc accatcccgt cgcgatcgtt tctggaccgc tttccactcc caaatctcct       720
     ttatcccaga gcatttcttg gcttctctta caagccgtct tttctttact cagtcgccaa       780
     tatgcagctc tttgtccgcg cccaggagct acacaccttc gaggtgaccg gccaggaaac       840
     ggtcgcccag atcaaggtaa ggctgcttgg tgcgccctgg gttccatttt cttgtgctct       900
     tcactctcgc ggcccgaggg aacgcttacg agccttatct ttccctgtag gctcatgtag       960
     cctcactgga gggcattgcc ccggaagatc aagtcgtgct cctggcaggc gcgcccctgg      1020
     aggatgaggc cactctgggc cagtgcgggg tggaggccct gactaccctg gaagtagcag      1080
     gccgcatgct tggaggtgag tgagagagga atgttctttg aagtaccggt aagcgtctag      1140
     tgagtgtggg gtgcatagtc ctgacagctg agtgtcacac ctatggtaat agagtacttc      1200
     tcactgtctt cagttcagag tgattcttcc tgtttacatc cctcatgttg aacacagacg      1260
     tccatgggag actgagccag agtgtagttg tatttcagtc acatcacgag atcctagtct      1320
     ggttatcagc ttccacacta aaaattaggt cagaccaggc cccaaagtgc tctataaatt      1380
     agaagctgga agatcctgaa atgaaactta agatttcaag gtcaaatatc tgcaactttg      1440
     ttctcattac ctattgggcg cagcttctct ttaaaggctt gaattgagaa aagaggggtt      1500
     ctgctgggtg gcaccttctt gctcttacct gctggtgcct tcctttccca ctacaggtaa      1560
     agtccatggt tccctggccc gtgctggaaa agtgagaggt cagactccta aggtgagtga      1620
     gagtattagt ggtcatggtg ttaggacttt ttttcctttc acagctaaac caagtccctg      1680
     ggctcttact cggtttgcct tctccctccc tggagatgag cctgagggaa gggatgctag      1740
     gtgtggaaga caggaaccag ggcctgatta accttccctt ctccaggtgg ccaaacagga      1800
     gaagaagaag aagaagacag gtcgggctaa gcggcggatg cagtacaacc ggcgctttgt      1860
     caacgttgtg cccacctttg gcaagaagaa gggccccaat gccaactctt aagtcttttg      1920
     taattctggc tttctctaat aaaaaagcca cttagttcag tcatcgcatt gtttcatctt      1980
     tacttgcaag gcctcaggga gaggtgtgct tctcgg                                2016
//

Output file format

Output files for usage example

File: x65921.fasta

>X65921_408_504 [exon] H.sapiens fau 1 gene
cagtgacgtgacacgcagcccacggtctgtactgacgcgccctcgcttcttcctctttct
cgactccatcttcgcggtagctgggaccgccgttcag
>X65921_774_856 [exon] H.sapiens fau 1 gene
tcgccaatatgcagctctttgtccgcgcccaggagctacacaccttcgaggtgaccggcc
aggaaacggtcgcccagatcaag
>X65921_951_1095 [exon] H.sapiens fau 1 gene
gctcatgtagcctcactggagggcattgccccggaagatcaagtcgtgctcctggcaggc
gcgcccctggaggatgaggccactctgggccagtgcggggtggaggccctgactaccctg
gaagtagcaggccgcatgcttggag
>X65921_1557_1612 [exon] H.sapiens fau 1 gene
gtaaagtccatggttccctggcccgtgctggaaaagtgagaggtcagactcctaag
>X65921_1787_1912 [exon] H.sapiens fau 1 gene
gtggccaaacaggagaagaagaagaagaagacaggtcgggctaagcggcggatgcagtac
aaccggcgctttgtcaacgttgtgcccacctttggcaagaagaagggccccaatgccaac
tcttaa

Output files for usage example 2

File: x65921.fasta

>X65921_408_504 [exon] H.sapiens fau 1 gene
ggtcgctcagcagtgacgtgacacgcagcccacggtctgtactgacgcgccctcgcttct
tcctctttctcgactccatcttcgcggtagctgggaccgccgttcaggtaagaatgg
>X65921_774_856 [exon] H.sapiens fau 1 gene
ctttactcagtcgccaatatgcagctctttgtccgcgcccaggagctacacaccttcgag
gtgaccggccaggaaacggtcgcccagatcaaggtaaggctgc
>X65921_951_1095 [exon] H.sapiens fau 1 gene
ttccctgtaggctcatgtagcctcactggagggcattgccccggaagatcaagtcgtgct
cctggcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggaggccct
gactaccctggaagtagcaggccgcatgcttggaggtgagtgaga
>X65921_1557_1612 [exon] H.sapiens fau 1 gene
cccactacaggtaaagtccatggttccctggcccgtgctggaaaagtgagaggtcagact
cctaaggtgagtgaga
>X65921_1787_1912 [exon] H.sapiens fau 1 gene
ccttctccaggtggccaaacaggagaagaagaagaagaagacaggtcgggctaagcggcg
gatgcagtacaaccggcgctttgtcaacgttgtgcccacctttggcaagaagaagggccc
caatgccaactcttaagtcttttgta

Output files for usage example 3

File: em498477.fasta

>X65921_408_504 [exon] H.sapiens fau 1 gene
ctcagcagtg
>X65921_774_856 [exon] H.sapiens fau 1 gene
ctcagtcgcc
>X65921_951_1095 [exon] H.sapiens fau 1 gene
tgtaggctca
>X65921_1557_1612 [exon] H.sapiens fau 1 gene
tacaggtaaa
>X65921_1787_1912 [exon] H.sapiens fau 1 gene
tccaggtggc
>K00650_889_1029 [exon] Human fos proto-oncogene (c-fos), complete cds.
ccacgatgat
>K00650_1783_2034 [exon] Human fos proto-oncogene (c-fos), complete cds.
tctaggactt
>K00650_2466_2573 [exon] Human fos proto-oncogene (c-fos), complete cds.
tctagttatc
>K00650_2688_3329 [exon] Human fos proto-oncogene (c-fos), complete cds.
tacaggagac
>D00596_1001_1205 [exon] Homo sapiens gene for thymidylate synthase, complete cds.
gcgccatgcc
>D00596_2895_2968 [exon] Homo sapiens gene for thymidylate synthase, complete cds.
ttcagatgaa
>D00596_5396_5570 [exon] Homo sapiens gene for thymidylate synthase, complete cds.
tccagggatc
>D00596_11843_11944 [exon] Homo sapiens gene for thymidylate synthase, complete cds.
tacagattat
>D00596_13449_13624 [exon] Homo sapiens gene for thymidylate synthase, complete cds.
ctcagatctt
>D00596_14133_14204 [exon] Homo sapiens gene for thymidylate synthase, complete cds.
tatagccagg
>D00596_15613_15750 [exon] Homo sapiens gene for thymidylate synthase, complete cds.
tttagcttca
>AB009071_67_155 [exon] Homo sapiens HERG gene, complete cds.
cccgcccatg
>AB009071_356_586 [exon] Homo sapiens HERG gene, complete cds.
cctaggccgt
>AB009071_768_932 [exon] Homo sapiens HERG gene, complete cds.
tgcagggagc
>AB009071_1137_1580 [exon] Homo sapiens HERG gene, complete cds.
cgcaggccgc
>AB009071_1742_1953 [exon] Homo sapiens HERG gene, complete cds.
cctaggggcc
>AB009071_2168_2596 [exon] Homo sapiens HERG gene, complete cds.
tgcaggtcct
>AB009071_2765_3152 [exon] Homo sapiens HERG gene, complete cds.
cccagctgat
>AB009071_3332_3531 [exon] Homo sapiens HERG gene, complete cds.
cccagccctc
>AB009071_3716_3968 [exon] Homo sapiens HERG gene, complete cds.
cccaggtgct


  [Part of this file has been deleted for brevity]

aacagctcct
>U01317_39414_39558 [exon] Human beta globin region on chromosome 11.
tccacacact
>U01317_39681_39903 [exon] Human beta globin region on chromosome 11.
cacaggctcc
>U01317_40770_40985 [exon] Human beta globin region on chromosome 11.
aacagctcct
>U01317_45710_45800 [exon] Human beta globin region on chromosome 11.
acactgtagt
>U01317_45922_46145 [exon] Human beta globin region on chromosome 11.
cacagtctcc
>U01317_46997_47124 [exon] Human beta globin region on chromosome 11.
cccagctctt
>U01317_54740_54881 [exon] Human beta globin region on chromosome 11.
tgcttacact
>U01317_55010_55232 [exon] Human beta globin region on chromosome 11.
ctcagattac
>U01317_56131_56389 [exon] Human beta globin region on chromosome 11.
cgcagctctt
>U01317_62137_62278 [exon] Human beta globin region on chromosome 11.
tgcttacatt
>U01317_62187_62278 [exon] Human beta globin region on chromosome 11.
acaccatggt
>U01317_62390_62408 [exon] Human beta globin region on chromosome 11.
attggtctat
>U01317_62409_62631 [exon] Human beta globin region on chromosome 11.
cttaggctgc
>U01317_63482_63742 [exon] Human beta globin region on chromosome 11.
cacagctcct
>M23100_1541_1923 [exon] Human insulin receptor (INSR) gene, exon 1, clones lambda-hINSR-(1-13).
ctccgggccc
>M23100_1542_1923 [exon] Human insulin receptor (INSR) gene, exon 1, clones lambda-hINSR-(1-13).
tccgggcccc
>M23100_1548_1923 [exon] Human insulin receptor (INSR) gene, exon 1, clones lambda-hINSR-(1-13).
ccccgagatc
>V00451_363_460 [exon] Glycine max leghemoglobin gene or pseudogene (no mRNA detected).
gaaatatggg
>V00451_555_663 [exon] Glycine max leghemoglobin gene or pseudogene (no mRNA detected).
aataggatat
>V00451_2182_2286 [exon] Glycine max leghemoglobin gene or pseudogene (no mRNA detected).
tgtaggtgcg
>V00451_3065_3208 [exon] Glycine max leghemoglobin gene or pseudogene (no mRNA detected).
cgtaggtggt
>M11903_351_499 [exon] Rattus norvegicus androgen-responsive protein precursor (Svf) gene, exons 1 and 1A, alternatively spliced.
cctgtaggca
>M11903_401_499 [exon] Rattus norvegicus androgen-responsive protein precursor (Svf) gene, exons 1 and 1A, alternatively spliced.
gctctcagtc
>M11904_109_445 [exon] Rattus norvegicus androgen-responsive protein precursor (Svf) gene, exon 2 and complete cds.
aacagaaaaa
>M11905_233_420 [exon] Rattus norvegicus androgen-responsive protein precursor (Svf) gene, exon 3.
cacaggttgt

Output files for usage example 4

File: x65921.fasta

>X65921_782_1912 [CDS] H.sapiens fau 1 gene
atgcagctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacg
gtcgcccagatcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtc
gtgctcctggcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggag
gccctgactaccctggaagtagcaggccgcatgcttggaggtaaagtccatggttccctg
gcccgtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaag
aagaagacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtg
cccacctttggcaagaagaagggccccaatgccaactcttaa

Output files for usage example 5

File: cru4_arath.fasta

>CRU4_ARATH_52_52 [post_translationally_modified_region] 12S seed storage protein CRU4 (Cruciferin 4) (AtCRU4) (Cruciferin A1) (Legumin-type globulin storage protein CRU4) (12S seed storage protein CRU4 alpha chain) (12S seed storage protein CRU4 acidic chain) (12S seed storage protein CRU4 beta chain) (12S seed storage protein CRU4 basic chain) (Precursor)
VLKSEAG
>CRU4_ARATH_96_96 [post_translationally_modified_region] 12S seed storage protein CRU4 (Cruciferin 4) (AtCRU4) (Cruciferin A1) (Legumin-type globulin storage protein CRU4) (12S seed storage protein CRU4 alpha chain) (12S seed storage protein CRU4 acidic chain) (12S seed storage protein CRU4 beta chain) (12S seed storage protein CRU4 basic chain) (Precursor)
AKLSFVA
>CRU4_ARATH_314_314 [post_translationally_modified_region] 12S seed storage protein CRU4 (Cruciferin 4) (AtCRU4) (Cruciferin A1) (Legumin-type globulin storage protein CRU4) (12S seed storage protein CRU4 alpha chain) (12S seed storage protein CRU4 acidic chain) (12S seed storage protein CRU4 beta chain) (12S seed storage protein CRU4 basic chain) (Precursor)
GYISTLN
>AQP1_HUMAN_247_247 [post_translationally_modified_region] Aquaporin-1 (AQP-1) (Aquaporin-CHIP) (Urine water channel) (Water channel protein for red blood cells and kidney proximal tubule)
VWTSGQV
>AQP1_HUMAN_262_262 [post_translationally_modified_region] Aquaporin-1 (AQP-1) (Aquaporin-CHIP) (Urine water channel) (Water channel protein for red blood cells and kidney proximal tubule)
DINSRVE
>GCN4_YEAST_17_17 [post_translationally_modified_region] General control protein GCN4 (Amino acid biosynthesis regulatory protein)
MGFSPLD
>GCN4_YEAST_218_218 [post_translationally_modified_region] General control protein GCN4 (Amino acid biosynthesis regulatory protein)
IPLSPIV
>OPSD_HUMAN_334_334 [post_translationally_modified_region] Rhodopsin (Opsin-2)
DEASATV
>OPSD_HUMAN_338_338 [post_translationally_modified_region] Rhodopsin (Opsin-2)
ATVSKTE
>OPSD_HUMAN_343_343 [post_translationally_modified_region] Rhodopsin (Opsin-2)
TETSQVA
>PAX3_HUMAN_201_201 [post_translationally_modified_region] Paired box protein Pax-3 (HuP2)
APQSDEG
>PAX3_HUMAN_205_205 [post_translationally_modified_region] Paired box protein Pax-3 (HuP2)
DEGSDID
>PAX3_HUMAN_209_209 [post_translationally_modified_region] Paired box protein Pax-3 (HuP2)
DIDSEPD
>PAXI_HUMAN_83_83 [post_translationally_modified_region] Paxillin
QPQSSSP
>PAXI_HUMAN_84_84 [post_translationally_modified_region] Paxillin
PQSSSPV
>PAXI_HUMAN_85_85 [post_translationally_modified_region] Paxillin
QSSSPVY
>PAXI_HUMAN_106_106 [post_translationally_modified_region] Paxillin
SVGSPCS
>PAXI_HUMAN_109_109 [post_translationally_modified_region] Paxillin
SPCSRVG
>PAXI_HUMAN_126_126 [post_translationally_modified_region] Paxillin
KQKSAEP
>PAXI_HUMAN_130_130 [post_translationally_modified_region] Paxillin
AEPSPTV
>PAXI_HUMAN_137_137 [post_translationally_modified_region] Paxillin
MSTSLGS
>PAXI_HUMAN_244_244 [post_translationally_modified_region] Paxillin
EMSSPQR
>PAXI_HUMAN_303_303 [post_translationally_modified_region] Paxillin
GRSSPGG
>UBR5_RAT_100_100 [post_translationally_modified_region] E3 ubiquitin-protein ligase UBR5 (6.3.2.-) (100 kDa protein) (E3 ubiquitin-protein ligase, HECT domain-containing 1) (Hyperplastic discs protein homolog)
TSDSPWF
>UBR5_RAT_342_342 [post_translationally_modified_region] E3 ubiquitin-protein ligase UBR5 (6.3.2.-) (100 kDa protein) (E3 ubiquitin-protein ligase, HECT domain-containing 1) (Hyperplastic discs protein homolog)
PVQSPVS
>UBR5_RAT_567_567 [post_translationally_modified_region] E3 ubiquitin-protein ligase UBR5 (6.3.2.-) (100 kDa protein) (E3 ubiquitin-protein ligase, HECT domain-containing 1) (Hyperplastic discs protein homolog)
QLRSPES
>UBR5_RAT_601_601 [post_translationally_modified_region] E3 ubiquitin-protein ligase UBR5 (6.3.2.-) (100 kDa protein) (E3 ubiquitin-protein ligase, HECT domain-containing 1) (Hyperplastic discs protein homolog)
PPPSPAS
>UBR5_RAT_797_797 [post_translationally_modified_region] E3 ubiquitin-protein ligase UBR5 (6.3.2.-) (100 kDa protein) (E3 ubiquitin-protein ligase, HECT domain-containing 1) (Hyperplastic discs protein homolog)
GQESPII
>UBR5_RAT_917_917 [post_translationally_modified_region] E3 ubiquitin-protein ligase UBR5 (6.3.2.-) (100 kDa protein) (E3 ubiquitin-protein ligase, HECT domain-containing 1) (Hyperplastic discs protein homolog)
ACVSVCF
>UBR5_RAT_1007_1007 [post_translationally_modified_region] E3 ubiquitin-protein ligase UBR5 (6.3.2.-) (100 kDa protein) (E3 ubiquitin-protein ligase, HECT domain-containing 1) (Hyperplastic discs protein homolog)
DPVSPPI
>UBR5_RAT_1216_1216 [post_translationally_modified_region] E3 ubiquitin-protein ligase UBR5 (6.3.2.-) (100 kDa protein) (E3 ubiquitin-protein ligase, HECT domain-containing 1) (Hyperplastic discs protein homolog)
KRTSPTA
>UBR5_RAT_1344_1344 [post_translationally_modified_region] E3 ubiquitin-protein ligase UBR5 (6.3.2.-) (100 kDa protein) (E3 ubiquitin-protein ligase, HECT domain-containing 1) (Hyperplastic discs protein homolog)
DPLSASS
>UBR5_RAT_1364_1364 [post_translationally_modified_region] E3 ubiquitin-protein ligase UBR5 (6.3.2.-) (100 kDa protein) (E3 ubiquitin-protein ligase, HECT domain-containing 1) (Hyperplastic discs protein homolog)
NQQSGTI
>UBR5_RAT_1470_1470 [post_translationally_modified_region] E3 ubiquitin-protein ligase UBR5 (6.3.2.-) (100 kDa protein) (E3 ubiquitin-protein ligase, HECT domain-containing 1) (Hyperplastic discs protein homolog)
VAESLIV
>UBR5_RAT_1730_1730 [post_translationally_modified_region] E3 ubiquitin-protein ligase UBR5 (6.3.2.-) (100 kDa protein) (E3 ubiquitin-protein ligase, HECT domain-containing 1) (Hyperplastic discs protein homolog)
AASSAGL
>UBR5_RAT_1769_1769 [post_translationally_modified_region] E3 ubiquitin-protein ligase UBR5 (6.3.2.-) (100 kDa protein) (E3 ubiquitin-protein ligase, HECT domain-containing 1) (Hyperplastic discs protein homolog)
YLTSASS
>UBR5_RAT_2016_2016 [post_translationally_modified_region] E3 ubiquitin-protein ligase UBR5 (6.3.2.-) (100 kDa protein) (E3 ubiquitin-protein ligase, HECT domain-containing 1) (Hyperplastic discs protein homolog)
FRRSDSM
>UBR5_RAT_2018_2018 [post_translationally_modified_region] E3 ubiquitin-protein ligase UBR5 (6.3.2.-) (100 kDa protein) (E3 ubiquitin-protein ligase, HECT domain-containing 1) (Hyperplastic discs protein homolog)
RSDSMTF
>UBR5_RAT_2061_2061 [post_translationally_modified_region] E3 ubiquitin-protein ligase UBR5 (6.3.2.-) (100 kDa protein) (E3 ubiquitin-protein ligase, HECT domain-containing 1) (Hyperplastic discs protein homolog)
GRPSQGL
>UBR5_RAT_2066_2066 [post_translationally_modified_region] E3 ubiquitin-protein ligase UBR5 (6.3.2.-) (100 kDa protein) (E3 ubiquitin-protein ligase, HECT domain-containing 1) (Hyperplastic discs protein homolog)
GLYSSSA
>UBR5_RAT_2279_2279 [post_translationally_modified_region] E3 ubiquitin-protein ligase UBR5 (6.3.2.-) (100 kDa protein) (E3 ubiquitin-protein ligase, HECT domain-containing 1) (Hyperplastic discs protein homolog)
GEGSGVA
>UBR5_RAT_2473_2473 [post_translationally_modified_region] E3 ubiquitin-protein ligase UBR5 (6.3.2.-) (100 kDa protein) (E3 ubiquitin-protein ligase, HECT domain-containing 1) (Hyperplastic discs protein homolog)
HGSSRSV
>UBR5_RAT_2475_2475 [post_translationally_modified_region] E3 ubiquitin-protein ligase UBR5 (6.3.2.-) (100 kDa protein) (E3 ubiquitin-protein ligase, HECT domain-containing 1) (Hyperplastic discs protein homolog)
SSRSVVD

The sequences of the specified features are written out.

The ID name of the sequence is formed from the original sequence name with the start and end positions of the feature appended to it. So if the feature came from a sequence with an ID name of 'XYZ' from positions 10 to 22, then the resulting ID name of the feature sequence will be 'XYZ_10_22'

The name of the type of feature is added to the start of the description of the sequence in brackets, e.g.: '[exon]'.

The sequence is written out as a normal sequence.

If the feature is in the reverse sense of a nucleic acid sequence, then it is reverse-complemented before being written.

Data files

None.

Notes

Bear in mind that database annotation cannot always be trusted to be reliable. If you rely upon annotation written by other people or another program and do not independently verify such annotation, then there is a chance that some of the reported features will be erreneous.

Controlling the output

There are many options to control exactly what parts of the feature table are written to file.

By default every feature in the feature table is extracted. -type will set the specific feature type to extract. See http://www.ebi.ac.uk/embl/WebFeindex.html for a list of the EMBL feature types and see Appendix A of the Swissprot user manual in http://www.uniprot.org/manual/sequence_annotation for a list of the Swissprot feature types.

By default any feature tag in the feature table is extracted. -tag specifies a feature tag reuired in any feature extracted. Tags are the types of extra values that a feature may have. For example in the EMBL feature table, a 'CDS' type of feature may have the tags /codon, /codon_start, /db_xref, /EC_number, /evidence, /exception, /function, /gene, /label, /map, /note, /number, /partial, /product, /protein_id,/pseudo, /standard_name, /translation, /transl_except, /transl_table, or /usedin. Some of these tags also have values, for example /gene can have the value of the gene name.

By default any feature tag value in the feature table is shown. You can set this using -tag to match any specific feature tag value you wish to show. Tag values are the values associated with a feature tag, for example /gene can have the value of the gene name. Bear in mind only some of these tags can have values.

By default any feature source in the feature table is shown. -source is used to set this to match a specific feature source.

By default features in either sense are extracted. The -sense option specifies a particular sense.

The minimum and maximum score of features to be reported may be specified with -minscore and -maxscore.

To aid you in identifying the type of feature that has been output, the type of feature is added to the start of the description of the output sequence. Sometimes the description of a sequence is lost in subsequent processing of the sequences file, so it is useful for the type to be a part of the output sequence ID name. The -featinname option specifies this behaviour.

To aid you in identifying the properties of a feature that has been output, -describe specifies one or more tag names that will be added to the output sequence "Description" text, together with their values (if any). For example, if this is set to be gene, then if any output feature has the tag (for example) /gene=BRCA1 associated with it, then the text (gene=BRCA1) will be added to the Description line. By default no feature tag is given in the "Description" text. You can set -describe to specify any feature tag you wish to show.

"Joined" features

Some features, such as CDS (coding sequence) and mRNA are composed of introns concatenated together. There may be other forms of 'joined' sequence, depending on the feature table. By default, 'joined' features are extracted as individual sequences. If the -join option is specified, then any group of these features will be output as a single sequence. If the -before and -after qualifiers have been set, then only the sequence before the first feature and after the last feature are added.

References

None.

Warnings

Diagnostic Error Messages

If the end position of the sequence to be written is less than the start position, then the warning message "Extraction region end less than start for feature type [start-end] in ID name" is written and no sequence is output.

Exit status

It always exits with status 0.

Known bugs

None.

See also

Program name Description
aligncopy Read and write alignments
aligncopypair Read and write pairs from alignments
biosed Replace or delete sequence sections
codcopy Copy and reformat a codon usage table
cutseq Remove a section from a sequence
degapseq Remove non-alphabetic (e.g. gap) characters from sequences
descseq Alter the name or description of a sequence
entret Retrieve sequence entries from flatfile databases and files
extractalign Extract regions from a sequence alignment
extractseq Extract regions from a sequence
featcopy Read and write a feature table
featmerge Merge two overlapping feature tables
featreport Read and write a feature table
feattext Return a feature table original text
listor Write a list file of the logical OR of two sets of sequences
makenucseq Create random nucleotide sequences
makeprotseq Create random protein sequences
maskambignuc Mask all ambiguity characters in nucleotide sequences with N
maskambigprot Mask all ambiguity characters in protein sequences with X
maskfeat Write a sequence with masked features
maskseq Write a sequence with masked regions
newseq Create a sequence file from a typed-in sequence
nohtml Remove mark-up (e.g. HTML tags) from an ASCII text file
noreturn Remove carriage return from ASCII files
nospace Remove whitespace from an ASCII text file
notab Replace tabs with spaces in an ASCII text file
notseq Write to file a subset of an input stream of sequences
nthseq Write to file a single sequence from an input stream of sequences
nthseqset Read and write (return) one set of sequences from many
pasteseq Insert one sequence into another
revseq Reverse and complement a nucleotide sequence
seqcount Read and count sequences
seqret Read and write (return) sequences
seqretsetall Read and write (return) many sets of sequences
seqretsplit Read sequences and write them to individual files
showfeat Display features of a sequence in pretty format
sizeseq Sort sequences by size
skipredundant Remove redundant sequences from an input set
skipseq Read and write (return) sequences, skipping first few
splitsource Split sequence(s) into original source sequences
splitter Split sequence(s) into smaller sequences
trimest Remove poly-A tails from nucleotide sequences
trimseq Remove unwanted characters from start and end of sequence(s)
trimspace Remove extra whitespace from an ASCII text file
twofeat Find neighbouring pairs of features in sequence(s)
union Concatenate multiple sequences into a single sequence
vectorstrip Remove vectors from the ends of nucleotide sequence(s)
yank Add a sequence reference (a full USA) to a list file

Author(s)

Gary Williams formerly at:
MRC Rosalind Franklin Centre for Genomics Research Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SB, UK

Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author.

History

Written (Dec 12 2001) - Gary Williams

Added '-join' parameter (June 2002) - Gary Williams

Target users

This program is intended to be used by everyone and everything, from naive users to embedded scripts.

Comments

None