featreport

 

Wiki

The master copies of EMBOSS documentation are available at http://emboss.open-bio.org/wiki/Appdocs on the EMBOSS Wiki.

Please help by correcting and extending the Wiki pages.

Function

Read and write a feature table

Description

featreport reads a sequence and a feature table and writes a standard report output.

Usage

Here is a sample session with featreport


% featreport 
Read and write a feature table
Input sequence: paamir.fasta
Input feature table: paamir.gff
Output report [x13776.featreport]: test.out

Go to the input files for this example
Go to the output files for this example

Command line arguments

Read and write a feature table
Version: EMBOSS:6.5.0.0

   Standard (Mandatory) qualifiers:
  [-sequence]          sequence   Sequence filename and optional format, or
                                  reference (input USA)
  [-features]          features   (no help text) features value
  [-outfile]           report     [*.featreport] Output report file name
                                  (default -rformat gff)

   Additional (Optional) qualifiers: (none)
   Advanced (Unprompted) qualifiers: (none)
   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin1            integer    Start of the sequence to be used
   -send1              integer    End of the sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -scircular1         boolean    Sequence is circular
   -sformat1           string     Input sequence format
   -iquery1            string     Input query fields or ID list
   -ioffset1           integer    Input start position offset
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name

   "-features" associated qualifiers
   -fformat2           string     Features format
   -iquery2            string     Input query fields or ID list
   -ioffset2           integer    Input start position offset
   -fopenfile2         string     Features file name
   -fask2              boolean    Prompt for begin/end/reverse
   -fbegin2            integer    Start of the features to be used
   -fend2              integer    End of the features to be used
   -freverse2          boolean    Reverse (if DNA)
   -fcircular2         boolean    Circular sequence features

   "-outfile" associated qualifiers
   -rformat3           string     Report format
   -rname3             string     Base file name
   -rextension3        string     File name extension
   -rdirectory3        string     Output directory
   -raccshow3          boolean    Show accession number in the report
   -rdesshow3          boolean    Show description in the report
   -rscoreshow3        boolean    Show the score in the report
   -rstrandshow3       boolean    Show the nucleotide strand in the report
   -rusashow3          boolean    Show the full USA in the report
   -rmaxall3           integer    Maximum total hits to report
   -rmaxseq3           integer    Maximum hits to report for one sequence

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write first file to standard output
   -filter             boolean    Read first file from standard input, write
                                  first file to standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options and exit. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages
   -version            boolean    Report version number and exit

Qualifier Type Description Allowed values Default
Standard (Mandatory) qualifiers
[-sequence]
(Parameter 1)
sequence Sequence filename and optional format, or reference (input USA) Readable sequence Required
[-features]
(Parameter 2)
features (no help text) features value Readable feature table Required
[-outfile]
(Parameter 3)
report Output report file name (default -rformat gff) <*>.featreport
Additional (Optional) qualifiers
(none)
Advanced (Unprompted) qualifiers
(none)
Associated qualifiers
"-sequence" associated sequence qualifiers
-sbegin1
-sbegin_sequence
integer Start of the sequence to be used Any integer value 0
-send1
-send_sequence
integer End of the sequence to be used Any integer value 0
-sreverse1
-sreverse_sequence
boolean Reverse (if DNA) Boolean value Yes/No N
-sask1
-sask_sequence
boolean Ask for begin/end/reverse Boolean value Yes/No N
-snucleotide1
-snucleotide_sequence
boolean Sequence is nucleotide Boolean value Yes/No N
-sprotein1
-sprotein_sequence
boolean Sequence is protein Boolean value Yes/No N
-slower1
-slower_sequence
boolean Make lower case Boolean value Yes/No N
-supper1
-supper_sequence
boolean Make upper case Boolean value Yes/No N
-scircular1
-scircular_sequence
boolean Sequence is circular Boolean value Yes/No N
-sformat1
-sformat_sequence
string Input sequence format Any string  
-iquery1
-iquery_sequence
string Input query fields or ID list Any string  
-ioffset1
-ioffset_sequence
integer Input start position offset Any integer value 0
-sdbname1
-sdbname_sequence
string Database name Any string  
-sid1
-sid_sequence
string Entryname Any string  
-ufo1
-ufo_sequence
string UFO features Any string  
-fformat1
-fformat_sequence
string Features format Any string  
-fopenfile1
-fopenfile_sequence
string Features file name Any string  
"-features" associated features qualifiers
-fformat2
-fformat_features
string Features format Any string  
-iquery2
-iquery_features
string Input query fields or ID list Any string  
-ioffset2
-ioffset_features
integer Input start position offset Any integer value 0
-fopenfile2
-fopenfile_features
string Features file name Any string  
-fask2
-fask_features
boolean Prompt for begin/end/reverse Boolean value Yes/No N
-fbegin2
-fbegin_features
integer Start of the features to be used Any integer value 0
-fend2
-fend_features
integer End of the features to be used Any integer value 0
-freverse2
-freverse_features
boolean Reverse (if DNA) Boolean value Yes/No N
-fcircular2
-fcircular_features
boolean Circular sequence features Boolean value Yes/No N
"-outfile" associated report qualifiers
-rformat3
-rformat_outfile
string Report format Any string gff
-rname3
-rname_outfile
string Base file name Any string  
-rextension3
-rextension_outfile
string File name extension Any string  
-rdirectory3
-rdirectory_outfile
string Output directory Any string  
-raccshow3
-raccshow_outfile
boolean Show accession number in the report Boolean value Yes/No N
-rdesshow3
-rdesshow_outfile
boolean Show description in the report Boolean value Yes/No N
-rscoreshow3
-rscoreshow_outfile
boolean Show the score in the report Boolean value Yes/No Y
-rstrandshow3
-rstrandshow_outfile
boolean Show the nucleotide strand in the report Boolean value Yes/No Y
-rusashow3
-rusashow_outfile
boolean Show the full USA in the report Boolean value Yes/No N
-rmaxall3
-rmaxall_outfile
integer Maximum total hits to report Any integer value 0
-rmaxseq3
-rmaxseq_outfile
integer Maximum hits to report for one sequence Any integer value 0
General qualifiers
-auto boolean Turn off prompts Boolean value Yes/No N
-stdout boolean Write first file to standard output Boolean value Yes/No N
-filter boolean Read first file from standard input, write first file to standard output Boolean value Yes/No N
-options boolean Prompt for standard and additional values Boolean value Yes/No N
-debug boolean Write debug output to program.dbg Boolean value Yes/No N
-verbose boolean Report some/full command line options Boolean value Yes/No Y
-help boolean Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose Boolean value Yes/No N
-warning boolean Report warnings Boolean value Yes/No Y
-error boolean Report errors Boolean value Yes/No Y
-fatal boolean Report fatal errors Boolean value Yes/No Y
-die boolean Report dying program messages Boolean value Yes/No Y
-version boolean Report version number and exit Boolean value Yes/No N

Input file format

featreport reads any nucleotide or protein sequences with features.

The input is a standard EMBOSS sequence query (also known as a 'USA') with associated feature information.

Major sequence database sources defined as standard in EMBOSS installations include srs:embl, srs:uniprot and ensembl

Data can also be read from sequence output in any supported format written by an EMBOSS or third-party application.

The input format can be specified by using the command-line qualifier -sformat xxx, where 'xxx' is replaced by the name of the required format. The available format names are: text, html, xml (uniprotxml), obo, embl (swissprot)

Where the sequence format has no feature information, a second file can be read to load the feature data. The file is specified with the qualifier -ufo xxx and the feature format is specified with the qualifier -fformat xxx

See: http://emboss.sf.net/docs/themes/SequenceFormats.html for further information on sequence formats.

See: http://emboss.sf.net/docs/themes/FeatureFormats.html for further information on feature formats.

Input files for usage example

File: paamir.fasta

>X13776 X13776.1 Pseudomonas aeruginosa amiC and amiR gene for aliphatic amidase regulation
ggtaccgctggccgagcatctgctcgatcaccaccagccgggcgacgggaactgcacgat
ctacctggcgagcctggagcacgagcgggttcgcttcgtacggcgctgagcgacagtcac
aggagaggaaacggatgggatcgcaccaggagcggccgctgatcggcctgctgttctccg
aaaccggcgtcaccgccgatatcgagcgctcgcacgcgtatggcgcattgctcgcggtcg
agcaactgaaccgcgagggcggcgtcggcggtcgcccgatcgaaacgctgtcccaggacc
ccggcggcgacccggaccgctatcggctgtgcgccgaggacttcattcgcaaccgggggg
tacggttcctcgtgggctgctacatgtcgcacacgcgcaaggcggtgatgccggtggtcg
agcgcgccgacgcgctgctctgctacccgaccccctacgagggcttcgagtattcgccga
acatcgtctacggcggtccggcgccgaaccagaacagtgcgccgctggcggcgtacctga
ttcgccactacggcgagcgggtggtgttcatcggctcggactacatctatccgcgggaaa
gcaaccatgtgatgcgccacctgtatcgccagcacggcggcacggtgctcgaggaaatct
acattccgctgtatccctccgacgacgacttgcagcgcgccgtcgagcgcatctaccagg
cgcgcgccgacgtggtcttctccaccgtggtgggcaccggcaccgccgagctgtatcgcg
ccatcgcccgtcgctacggcgacggcaggcggccgccgatcgccagcctgaccaccagcg
aggcggaggtggcgaagatggagagtgacgtggcagaggggcaggtggtggtcgcgcctt
acttctccagcatcgatacgcccgccagccgggccttcgtccaggcctgccatggtttct
tcccggagaacgcgaccatcaccgcctgggccgaggcggcctactggcagaccttgttgc
tcggccgcgccgcgcaggccgcaggcaactggcgggtggaagacgtgcagcggcacctgt
acgacatcgacatcgacgcgccacaggggccggtccgggtggagcgccagaacaaccaca
gccgcctgtcttcgcgcatcgcggaaatcgatgcgcgcggcgtgttccaggtccgctggc
agtcgcccgaaccgattcgccccgacccttatgtcgtcgtgcataacctcgacgactggt
ccgccagcatgggcgggggaccgctcccatgagcgccaactcgctgctcggcagcctgcg
cgagttgcaggtgctggtcctcaacccgccgggggaggtcagcgacgccctggtcttgca
gctgatccgcatcggttgttcggtgcgccagtgctggccgccgccggaagccttcgacgt
gccggtggacgtggtcttcaccagcattttccagaatggccaccacgacgagatcgctgc
gctgctcgccgccgggactccgcgcactaccctggtggcgctggtggagtacgaaagccc
cgcggtgctctcgcagatcatcgagctggagtgccacggcgtgatcacccagccgctcga
tgcccaccgggtgctgcctgtgctggtatcggcgcggcgcatcagcgaggaaatggcgaa
gctgaagcagaagaccgagcagctccaggaccgcatcgccggccaggcccggatcaacca
ggccaaggtgttgctgatgcagcgccatggctgggacgagcgcgaggcgcaccagcacct
gtcgcgggaagcgatgaagcggcgcgagccgatcctgaagatcgctcaggagttgctggg
aaacgagccgtccgcctgagcgatccgggccgaccagaacaataacaagaggggtatcgt
catcatgctgggactggttctgctgtacgttggcgcggtgctgtttctcaatgccgtctg
gttgctgggcaagatcagcggtcgggaggtggcggtgatcaacttcctggtcggcgtgct
gagcgcctgcgtcgcgttctacctgatcttttccgcagcagccgggcagggctcgctgaa
ggccggagcgctgaccctgctattcgcttttacctatctgtgggtggccgccaaccagtt
cctcgag

File: paamir.gff

##gff-version 2.0
##date 2003-02-14
##Type DNA PAAMIR
PAAMIR	EMBL	source	1	2167	0.000	+	.	Sequence "PAAMIR.1" ; db_xref "taxon:287" ; organism "Pseudomonas aeruginosa" ; strain "PAC" ; isolate "PAC 1" ; map "38 min"
PAAMIR	EMBL	CDS	1289	1879	0.000	+	.	Sequence "PAAMIR.2" ; db_xref "SWISS-PROT:P10932" ; note "aliphatic amidase regulator, positive regulator of amiE" ; transl_table 11 ; gene "amiR" ; protein_id "CAA32023.1" ; translation "MSANSLLGSLRELQVLVLNPPGEVSDALVLQLIRIGCSVRQCWPPPEAFDVPVDVVFTSIFQNGHHDEIAALLAAGTPRTTLVALVEYESPAVLSQIIELECHGVITQPLDAHRVLPVLVSARRISEEMAKLKQKTEQLQDRIAGQARINQAKVLLMQRHGWDEREAHQHLSREAMKRREPILKIAQELLGNEPSA"
PAAMIR	EMBL	CDS	135	1292	0.000	+	.	Sequence "PAAMIR.3" ; db_xref "SWISS-PROT:P27017" ; note "negative regulator of amiR" ; transl_table 11 ; gene "amiC" ; protein_id "CAA32024.1" ; translation "MGSHQERPLIGLLFSETGVTADIERSHAYGALLAVEQLNREGGVGGRPIETLSQDPGGDPDRYRLCAEDFIRNRGVRFLVGCYMSHTRKAVMPVVERADALLCYPTPYEGFEYSPNIVYGGPAPNQNSAPLAAYLIRHYGERVVFIGSDYIYPRESNHVMRHLYRQHGGTVLEEIYIPLYPSDDDLQRAVERIYQARADVVFSTVVGTGTAELYRAIARRYGDGRRPPIASLTTSEAEVAKMESDVAEGQVVVAPYFSSIDTPASRAFVQACHGFFPENATITAWAEAAYWQTLLLGRAAQAAGNWRVEDVQRHLYDIDIDAPQGPVRVERQNNHSRLSSRIAEIDARGVFQVRWQSPEPIRPDPYVVVHNLDDWSASMGGGPLP"
PAAMIR	EMBL	promoter	8	24	0.000	+	.	Sequence "PAAMIR.4" ; note "proposed rpoN-dependent promoter"
PAAMIR	EMBL	promoter	65	81	0.000	+	.	Sequence "PAAMIR.5" ; note "proposed rpoN-dependent promoter"
PAAMIR	EMBL	RBS	121	126	0.000	+	.	Sequence "PAAMIR.6" ; note "proposed Shine-Dalgarno sequence"
PAAMIR	EMBL	variation	912	1167	0.000	+	.	Sequence "PAAMIR.7" ; note "ClaI fragment deleted in pSW36, constitutive phenotype" ; replace "" ; gene "amiC"
PAAMIR	EMBL	misc_feature	1	1	0.000	+	.	Sequence "PAAMIR.8" ; FeatFlags "0x40" ; note "last base of an XhoI site"
PAAMIR	EMBL	misc_feature	648	653	0.000	+	.	Sequence "PAAMIR.9" ; note "end of 658bp XhoI fragment, deletion in pSW3 causes constitutive expression of amiE"
PAAMIR	EMBL	conflict	1281	1281	0.000	+	.	Sequence "PAAMIR.10" ; FeatFlags "0x40" ; replace "g" ; citation [3]

Output file format

The output is a standard EMBOSS report file.

The results can be output in one of several styles by using the command-line qualifier -rformat xxx, where 'xxx' is replaced by the name of the required format. The available format names are: embl, genbank, gff, pir, swiss, dasgff, debug, listfile, dbmotif, diffseq, draw, restrict, excel, feattable, motif, nametable, regions, seqtable, simple, srs, table, tagseq.

See: http://emboss.sf.net/docs/themes/ReportFormats.html for further information on report formats.

By default the report is in 'gff' feature format.

Output files for usage example

File: test.out

##gff-version 3
##sequence-region PAAMIR 1 2167
#!Date 2012-07-15
#!Type DNA
#!Source-version EMBOSS 6.5.0.0
PAAMIR	EMBL	databank_entry	1	2167	.	+	.	ID=PAAMIR.1;db_xref=taxon:287;organism=Pseudomonas aeruginosa;strain=PAC;isolate=PAC 1;map=38 min
PAAMIR	EMBL	CDS	1289	1879	.	+	0	ID=PAAMIR.2;db_xref=SWISS-PROT:P10932;note=aliphatic amidase regulator%2C positive regulator of amiE;transl_table=11;gene=amiR;protein_id=CAA32023.1;translation=MSANSLLGSLRELQVLVLNPPGEVSDALVLQLIRIGCSVRQCWPPPEAFDVPVDVVFTSIFQNGHHDEIAALLAAGTPRTTLVALVEYESPAVLSQIIELECHGVITQPLDAHRVLPVLVSARRISEEMAKLKQKTEQLQDRIAGQARINQAKVLLMQRHGWDEREAHQHLSREAMKRREPILKIAQELLGNEPSA
PAAMIR	EMBL	CDS	135	1292	.	+	0	ID=PAAMIR.3;db_xref=SWISS-PROT:P27017;note=negative regulator of amiR;transl_table=11;gene=amiC;protein_id=CAA32024.1;translation=MGSHQERPLIGLLFSETGVTADIERSHAYGALLAVEQLNREGGVGGRPIETLSQDPGGDPDRYRLCAEDFIRNRGVRFLVGCYMSHTRKAVMPVVERADALLCYPTPYEGFEYSPNIVYGGPAPNQNSAPLAAYLIRHYGERVVFIGSDYIYPRESNHVMRHLYRQHGGTVLEEIYIPLYPSDDDLQRAVERIYQARADVVFSTVVGTGTAELYRAIARRYGDGRRPPIASLTTSEAEVAKMESDVAEGQVVVAPYFSSIDTPASRAFVQACHGFFPENATITAWAEAAYWQTLLLGRAAQAAGNWRVEDVQRHLYDIDIDAPQGPVRVERQNNHSRLSSRIAEIDARGVFQVRWQSPEPIRPDPYVVVHNLDDWSASMGGGPLP
PAAMIR	EMBL	promoter	8	24	.	+	.	ID=PAAMIR.4;note=proposed rpoN-dependent promoter
PAAMIR	EMBL	promoter	65	81	.	+	.	ID=PAAMIR.5;note=proposed rpoN-dependent promoter
PAAMIR	EMBL	ribosome_entry_site	121	126	.	+	.	ID=PAAMIR.6;note=proposed Shine-Dalgarno sequence
PAAMIR	EMBL	sequence_variant	912	1167	.	+	.	ID=PAAMIR.7;note=ClaI fragment deleted in pSW36%2C constitutive phenotype;replace=;gene=amiC
PAAMIR	EMBL	sequence_feature	1	1	.	+	.	ID=PAAMIR.8;note=last base of an XhoI site
PAAMIR	EMBL	sequence_feature	648	653	.	+	.	ID=PAAMIR.9;note=end of 658bp XhoI fragment%2C deletion in pSW3 causes constitutive expression of amiE
PAAMIR	EMBL	sequence_conflict	1281	1281	.	+	.	ID=PAAMIR.10;replace=g;citation=[3]

Data files

None.

Notes

None.

References

None.

Warnings

None.

Diagnostic Error Messages

None.

Exit status

It always exits with status 0.

Known bugs

None.

See also

Program name Description
aligncopy Read and write alignments
aligncopypair Read and write pairs from alignments
biosed Replace or delete sequence sections
codcopy Copy and reformat a codon usage table
cutseq Remove a section from a sequence
degapseq Remove non-alphabetic (e.g. gap) characters from sequences
descseq Alter the name or description of a sequence
entret Retrieve sequence entries from flatfile databases and files
extractalign Extract regions from a sequence alignment
extractfeat Extract features from sequence(s)
extractseq Extract regions from a sequence
featcopy Read and write a feature table
featmerge Merge two overlapping feature tables
feattext Return a feature table original text
listor Write a list file of the logical OR of two sets of sequences
makenucseq Create random nucleotide sequences
makeprotseq Create random protein sequences
maskambignuc Mask all ambiguity characters in nucleotide sequences with N
maskambigprot Mask all ambiguity characters in protein sequences with X
maskfeat Write a sequence with masked features
maskseq Write a sequence with masked regions
newseq Create a sequence file from a typed-in sequence
nohtml Remove mark-up (e.g. HTML tags) from an ASCII text file
noreturn Remove carriage return from ASCII files
nospace Remove whitespace from an ASCII text file
notab Replace tabs with spaces in an ASCII text file
notseq Write to file a subset of an input stream of sequences
nthseq Write to file a single sequence from an input stream of sequences
nthseqset Read and write (return) one set of sequences from many
pasteseq Insert one sequence into another
revseq Reverse and complement a nucleotide sequence
seqcount Read and count sequences
seqret Read and write (return) sequences
seqretsetall Read and write (return) many sets of sequences
seqretsplit Read sequences and write them to individual files
sizeseq Sort sequences by size
skipredundant Remove redundant sequences from an input set
skipseq Read and write (return) sequences, skipping first few
splitsource Split sequence(s) into original source sequences
splitter Split sequence(s) into smaller sequences
trimest Remove poly-A tails from nucleotide sequences
trimseq Remove unwanted characters from start and end of sequence(s)
trimspace Remove extra whitespace from an ASCII text file
union Concatenate multiple sequences into a single sequence
vectorstrip Remove vectors from the ends of nucleotide sequence(s)
yank Add a sequence reference (a full USA) to a list file

Author(s)

Peter Rice
European Bioinformatics Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge CB10 1SD, UK

Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author.

History

Target users

This program is intended to be used by everyone and everything, from naive users to embedded scripts.

Comments

None