makenucseq |
Please help by correcting and extending the Wiki pages.
makenucseq writes an output file with a set of random nucleotide sequences. The sequence composition is defined from reading a codon usage file: the sequences are created with triplet frequencies matching those given in the file, with the end trimmed to be in the correct reading frame. The number of sequences to create and length of each sequence is specified. Optionally, a user-defined string may be inserted into each output sequence at a specified position
% makenucseq Create random nucleotide sequences Codon usage file (optional): Number of sequences created [100]: Length of each sequence [100]: nucleotide output sequence(s) [makeseq.fasta]: |
Go to the output files for this example
Example 2
Providing a codon usage file specifies the sequence composition. This Pseudomonas aeruginosa file specifies a high GC content.
% makenucseq Create random nucleotide sequences Codon usage file (optional): Epseae.cut Number of sequences created [100]: Length of each sequence [100]: nucleotide output sequence(s) [makeseq.fasta]: |
Go to the output files for this example
Create random nucleotide sequences Version: EMBOSS:6.5.0.0 Standard (Mandatory) qualifiers (* if not always prompted): -codonfile codon Optional codon usage file. Nucleotide sequences will be created as triplets matching the frequencies in the file, with the end trimmed to be in the correct reading frame. -amount integer [100] Number of sequences created (Integer 1 or more) -length integer [100] Length of each sequence (Integer 1 or more) * -insert string String that is inserted into sequence (Any string) * -start integer [1] Start point of inserted sequence (Integer 1 or more) [-outseq] seqoutall [ |
Qualifier | Type | Description | Allowed values | Default |
---|---|---|---|---|
Standard (Mandatory) qualifiers | ||||
-codonfile | codon | Optional codon usage file. Nucleotide sequences will be created as triplets matching the frequencies in the file, with the end trimmed to be in the correct reading frame. | Codon usage file in EMBOSS data path | |
-amount | integer | Number of sequences created | Integer 1 or more | 100 |
-length | integer | Length of each sequence | Integer 1 or more | 100 |
-insert | string | String that is inserted into sequence | Any string | |
-start | integer | Start point of inserted sequence | Integer 1 or more | 1 |
[-outseq] (Parameter 1) |
seqoutall | Nucleotide sequence set(s) filename and optional format (output USA) | Writeable sequence(s) | <*>.format |
Additional (Optional) qualifiers | ||||
-useinsert | toggle | Do you want to make an insert | Toggle value Yes/No | No |
Advanced (Unprompted) qualifiers | ||||
(none) | ||||
Associated qualifiers | ||||
"-codonfile" associated codon qualifiers | ||||
-format | string | Data format | Any string | |
"-outseq" associated seqoutall qualifiers | ||||
-osformat1 -osformat_outseq |
string | Output seq format | Any string | |
-osextension1 -osextension_outseq |
string | File name extension | Any string | |
-osname1 -osname_outseq |
string | Base file name | Any string | |
-osdirectory1 -osdirectory_outseq |
string | Output directory | Any string | |
-osdbname1 -osdbname_outseq |
string | Database name to add | Any string | |
-ossingle1 -ossingle_outseq |
boolean | Separate file for each entry | Boolean value Yes/No | N |
-oufo1 -oufo_outseq |
string | UFO features | Any string | |
-offormat1 -offormat_outseq |
string | Features format | Any string | |
-ofname1 -ofname_outseq |
string | Features file name | Any string | |
-ofdirectory1 -ofdirectory_outseq |
string | Output directory | Any string | |
General qualifiers | ||||
-auto | boolean | Turn off prompts | Boolean value Yes/No | N |
-stdout | boolean | Write first file to standard output | Boolean value Yes/No | N |
-filter | boolean | Read first file from standard input, write first file to standard output | Boolean value Yes/No | N |
-options | boolean | Prompt for standard and additional values | Boolean value Yes/No | N |
-debug | boolean | Write debug output to program.dbg | Boolean value Yes/No | N |
-verbose | boolean | Report some/full command line options | Boolean value Yes/No | Y |
-help | boolean | Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose | Boolean value Yes/No | N |
-warning | boolean | Report warnings | Boolean value Yes/No | Y |
-error | boolean | Report errors | Boolean value Yes/No | Y |
-fatal | boolean | Report fatal errors | Boolean value Yes/No | Y |
-die | boolean | Report dying program messages | Boolean value Yes/No | Y |
-version | boolean | Report version number and exit | Boolean value Yes/No | N |
The input is a standard EMBOSS codon usage query.
Data can also be read from codon usage output in any supported format written by an EMBOSS or third party application.
The input format can be specified by using the command-line qualifier -format xxx, where 'xxx' is replaced by the name of the required format. The available format names are: emboss, cut, gcg, cutg, cutgaa, spsum, cherry, transterm, codehop, staden and numstaden.
>EMBOSS_001 ggtccgaggggtagcttgatcgcctcttttgggaacgcaagcgtggccggtatgataaaa taaaatgcgctccgctctggtaagacggacggtcgcccta >EMBOSS_002 tttcaatccattaggagatccttccgggcttactcttttttggtaggaatacagacgaat gtgttgttgacactacaagtacgaactgtgatcgcaccct >EMBOSS_003 aacggctgttagaccgcatcattttggcaggaaccttgggtcggttcatctcttgggtat gacagcacagggaggtttgagagctgcctcccggattttg >EMBOSS_004 atcgaagagacgcattcctatagtatcaatccttgacgtcggcatggttcggatcttacg cgaagccctacgactccctaccggtattgtatcgttctag >EMBOSS_005 agagttcgtctacacatgggcacccttactacttgagtgcttaccaaaagtacgatccac gaaacgtcgagcactggcatgcacacgctctccgacgtat >EMBOSS_006 caatcctcattgcttacacggccacaacaggaagtgcctcaagctgtagagcataggcat gttctcaagatcgcgttaacagccattgctggagaatggc >EMBOSS_007 actcggagttcaaccgccgctgtgggctgagctatccctaatgacccgcgcgtagagtgt taaaatctttcgacagtcacctgcacatcgttgtcttctg >EMBOSS_008 cgagggtcattctaaatttgagggtaatgctcgcgccatgcgacttgtcgggaaagcggc cctttatgcgttgccggtcggcattgcccaaccctagtga >EMBOSS_009 gttatcacgtccaattaggtgggccacaatacgtcggcagaatcaagtgcataacggaga ggtcactaggacgttactgtcattccctgccccgctatgt >EMBOSS_010 tatgtttctcgtgctcagcttagaccggagagctccacccaataggccgcacacaagggg tctttaggatacccccccccttattaccccacagcaacag >EMBOSS_011 agacgcgccgctcgtagtatgttacctcccttacctgaggacctgcgtggatggcggcaa cgtgcctcaaagcccgcagcgaatggaaagcaggttggtg >EMBOSS_012 accctcgcgctgtcgtgtatatttctagcgatgagctagttcgtgcggccatggttctgg atgcatggctatggtttgttcagacggaatagtccgggac >EMBOSS_013 accctgacagctcttaccctctatggacggacagggcatgaccgtgcatgacctggcaga gaacggcttcatattagggagcagcagaatcgtgtatcgt >EMBOSS_014 tcctgccgggaattagagacaaaaagattgtgaccttcacagcctcctactttcttttgt tagtatggggcttgacactatacactgggacaatttagaa >EMBOSS_015 ccgtagcaaggccacagttacgaaggtcatgttcccacccacagcgttgttcccttttac cgacccacgcctagaatttctcgaagaacagaaaccaccc >EMBOSS_016 cttctcccgtaagaaccttcgtccaacatccaatcaatcacggtgggtacgaggtatacc tatctgtcacgaaatcctaagacatttctgcaaacagggg >EMBOSS_017 cagtagttgatgcacgtaacatttactcattggacaacagcacagtagctcccatcacat [Part of this file has been deleted for brevity] >EMBOSS_084 ttaccatttaaacatgtccagatacggacaggtcgcactgtccttgggccacttttctgt tacgcgcgtgagcttatgatgacgaatcgcgggaagggat >EMBOSS_085 cctcactctctcagaccccgaatcctaagtgatcaatacctctacgtcttggttttgccg ctgatatcatgatatacatgagtctagcacggtctcctac >EMBOSS_086 aggcagggtatagtgctctagagtacaccccttgcgtgaaatcggcgtcctggtggtcga ttaccctcaagcacttttcctcagttcggggggtcacgat >EMBOSS_087 ataagtctaccaatgaaacgatcgcgaatcggacgccactcgccagggtattcgcgcttc acattatatatagtccggaagcacgactctccatttggtt >EMBOSS_088 tctatccgtgcctcccacgggtcagatatatgctctggacgtagtggtgccgcatctgtg tacatgactaaagctacgactttttcgcgtagccaatcca >EMBOSS_089 ccgccgtaactttcccgggtagggggctaccgacgataatctagcgtttgatagcgtctg gcgcatgtgtcatagggtgctggtgtccttgggcagtaca >EMBOSS_090 acgaatccccctttccacacgacaaaaacgagaccggtagctttgggcgagacgtacgct gactaagcaatcgaagcccttcaagtacgctgccagtcaa >EMBOSS_091 gtgacctgagacttgagctactaatgcacttgtacgagggcttacaaaaagaacggatca aagcaagccctcgggatgtgtgacccaggcgtttgccgtg >EMBOSS_092 accgttcgagagatctcacaactagcacatatacgccagaggtagtcacacagattaaga tggtgcgacagctcgcgcaaccacacggggatgacacgta >EMBOSS_093 aaccctaaccgagggtttgtggctaacatcagccccactgtgcccgcaacgtcccaaatt gactctatctcgttccaacactttaaatgcttatgtatat >EMBOSS_094 gtctggtacgttcagcgcgattagccgggcgctccggaccggatgtcctaccaggtacac ctatccagtaccacggcgcggtgtagccgtacctcaaagc >EMBOSS_095 taggttggatagacgacggtctgtcaaggctcaccaagggttaatctgcctctgataagt gttggactatgggggcaacgcctcgaccagttgaacctgt >EMBOSS_096 gaccgtggtgcattctagtacgtatgagcatccaaacatgcgccacatgtaccagggtga tgctggagtcgctgtggaacaagagcgttctaccccctcg >EMBOSS_097 atcataggcccaagtcggatcatgtttatccgagtttaacaagttctgcagtggcagaaa agtgtctttttagcagctcccctattgccacggctgctac >EMBOSS_098 taactagcagtttcgttatttaagagacttatgcgttaataaaatcttgttatggggcca ccagtccttattaatccgtaaggagacgagccgcctggag >EMBOSS_099 tcgggatgggaactgtagtaagtaaatacagcagaacaagaccagctgtaggaccgcaag taattcgcatggggccttgctctctacaatcacggcagcc >EMBOSS_100 taaatcggcatggtggagttatctttaagattgcaccatatgtggccgagccggaaaagc ttatggggtgccaggtttagcctcttgttacatagtgacg |
>EMBOSS_001 gggcgtctgggcgccgtcacggtcggccgctacctcgacccggcgttctccgtcaacttc gcgcggcagggcttcatctgactgctgttcggcgtgcgcg >EMBOSS_002 gacgccggcgcgaccgagcggcaccgcttcgtccgaggaggcggcggcttcaccctcgtg gccttcgacgacagcaccctggaagagaaggactacccgg >EMBOSS_003 cgcgccttcgccgccggtggcctgcactggggggttctgaccgagggcaggatcggccgc aggggcccggtgctgatcgtcgcccaccacctgaccctgc >EMBOSS_004 ctgcagaaggacttaatgcacaccctgttcaagcggggtaaacccgagctgggcatcctg ttcggccagcgcgtgccggccttgtcgaccggctacggcc >EMBOSS_005 ttcctctcctacctgcgctacctgaacgtgccagaagagtccagcggcgaacgcagcgcc ggcaccgacctgcgctcccccttcctgcggctgtgaggtg >EMBOSS_006 gccgacgcgtgcgaccataccgaccgcctggacatccgcagcaccatgttccccctgcgc gagctcatccgcgcggaggcgatcatctacgacgagggcg >EMBOSS_007 ccgcacctgcgcctgctgaccgtgaacgccattccggccaattggatcacctcgtgcctg ctggtgggcatcaagggcgggaccgaggccggcttcctgg >EMBOSS_008 ggcggcctggcgcctcgctatcgtgccaactgcatcttcgcgctgctgcggcggccgctg gacctgccggatgcggaggtcgccgagagtgacccggttg >EMBOSS_009 aagggcccgctgctctcagggaacgtcacgcgcgcgtacgtcggcgcggaagccgccgcg gttgtggccctgtcgctgctgcgggactatgccgtagaga >EMBOSS_010 gtcgacggtaaggccgtggcgacctcgttccaggccctggaacttgagggctccacctcg ggaaaagagctgatgatccgttacgtaagcggccgccgtc >EMBOSS_011 cggcgcgcggcactcccggtctcgttcgccccgcggaactggcacctgtggacgatccgc caagtcgagaagtaaggccacgccctcacgggccgcaaga >EMBOSS_012 tatcaggcccagctcgagcaacaccatccgtgcagctgactcggccgtaattggcagcat ctttcgatcttggccccgaagggtaagcgcttgctggcgg >EMBOSS_013 ctgatctacacccatgcccagaccctagtgggcccgcacaaggcgcaccaacgttgaact ggctgagaccagtgggaaccgaaacgctacgggggcctcc >EMBOSS_014 gccatggccaccaacgaagatggctgcgccatccgcagcctccagcaggacgcgggcgag acggaccaaccgctgcacggcgacgtgatgaacattttcg >EMBOSS_015 cgccagagctcgcgcggcgaggcgacccagggcgcgctgcagtggggacaggtcaacgcg ccgctggacttcgcgagcaacctgcagatgctcattgagc >EMBOSS_016 ctgggcgcgtcgctggagggcgaccacggcgtggcgcagaaagctaatgccagtgatggt gtcgatacccgactgcctgcgatgtgggccgacaagccga >EMBOSS_017 ctcggcttcagccccacccctgcgagcctggacgtgggcgctaagttcggcctctcgggc [Part of this file has been deleted for brevity] >EMBOSS_084 ctgcgccacctgcgcggggaaaacggcatcgccacgatgtcggagatcggtgagtacgcg agcaagcggggcatggaagccgaggccttcctgagcacac >EMBOSS_085 cactactacatccgcctgctgctgcaggccaccatcttcctggtcagccgcacgcgcacc ggcgtattgattatctgtcgctttgagccggtgtttaaga >EMBOSS_086 actgccgagatcaagcagtacggtgcgccgccggcaccgggtgacgccctcggcgaccgc gactgccgcggcgccgtgggtctgctgagccgccaatccg >EMBOSS_087 cggaggaacaccagcgacatctatgaatggttcctgcagctggccaccgtgtcgctgatc gccgaggagctcatcaacttccgtaccggccagaatgccc >EMBOSS_088 gggatcctggacgaagcggccgccttctcgaaggagaacagaagctactatccggacggc ctgtacacccacgtgtacaagcgcaacgagcaatggcgga >EMBOSS_089 gcgctgctgcgcgcccgctcgaaatgggatcgctacgagaacatcgccaagtacctgatg aaggaggaggcagacgccgaccaggaacaggtcaccctcc >EMBOSS_090 ccgatcgacggctacggtaccaacctgtacgccccgatgccgcatctgggcaggagcgac cccccgcgcgccctcgggcccccaattcaacagatcgctc >EMBOSS_091 gcgaaccactcgaacgttctggtgatggcgcataccaattacaaccgcgacgccggccgt atcccctaccaaccgagtcgacacaccggcgaggccggcg >EMBOSS_092 tccatcgagaaggccatcccgccggtccgtatcaaggggctggccggccgcccgtgcctc ctaggccgggcgagcctagcgaccatcgcctatgacgcca >EMBOSS_093 attctgcccgacgaagacctctacgagatccgcggcttcatgcacaaggccgggcatgcg gacccgggcgacgaacatatcaccgtgccgctcaggcacc >EMBOSS_094 cgcgtctacccgcgtcaggacgcgctgaccgccgtcctggtgaaccgccttgacaatttc ctgaccctgggcaaccagatgctggagctcaacgtccaat >EMBOSS_095 gacctgatggagcatttcagctcgtacctgtccctggccggcggcctcttaggcataaag cgcaccgccccgctatcccgtatcgggacggccctggata >EMBOSS_096 tgactggtcagctacggccgcttcctgctcatcgccccgctgggtctgcggacggagttc gaacagctgtccctgggcggcgagccgggcccggccgacc >EMBOSS_097 gcccatcggggtcgctgcgtgaatccgtgcgttggagcgcggcgcgcctgcgaaaacctg ccgctgtcgccggcggtgctgctggaggtggtccgcagcg >EMBOSS_098 cgcgcccctatggaacgcctgttcgcggcgttcgcgatcgccatcctggggatcatggtg ttcgccatgctggacatcagcatcgaagagcgtttcccgc >EMBOSS_099 gcgaagtgccgcaccttcgtgggcagctacacgattcagagtttggacacccgggagacg aagcagaccgtcatcgatgaggagaccaagaccaaattga >EMBOSS_100 ctcggccggcaactgcggcgcgaaccgatgccgccctacgcggccctgcgttagatggac ctcgcccccgcccgcgaccgagtcgcgctcgacacggtcg |
Program name | Description |
---|---|
aligncopy | Read and write alignments |
aligncopypair | Read and write pairs from alignments |
biosed | Replace or delete sequence sections |
codcopy | Copy and reformat a codon usage table |
cutseq | Remove a section from a sequence |
degapseq | Remove non-alphabetic (e.g. gap) characters from sequences |
descseq | Alter the name or description of a sequence |
entret | Retrieve sequence entries from flatfile databases and files |
extractalign | Extract regions from a sequence alignment |
extractfeat | Extract features from sequence(s) |
extractseq | Extract regions from a sequence |
featcopy | Read and write a feature table |
featmerge | Merge two overlapping feature tables |
featreport | Read and write a feature table |
feattext | Return a feature table original text |
listor | Write a list file of the logical OR of two sets of sequences |
makeprotseq | Create random protein sequences |
maskambignuc | Mask all ambiguity characters in nucleotide sequences with N |
maskambigprot | Mask all ambiguity characters in protein sequences with X |
maskfeat | Write a sequence with masked features |
maskseq | Write a sequence with masked regions |
newseq | Create a sequence file from a typed-in sequence |
nohtml | Remove mark-up (e.g. HTML tags) from an ASCII text file |
noreturn | Remove carriage return from ASCII files |
nospace | Remove whitespace from an ASCII text file |
notab | Replace tabs with spaces in an ASCII text file |
notseq | Write to file a subset of an input stream of sequences |
nthseq | Write to file a single sequence from an input stream of sequences |
nthseqset | Read and write (return) one set of sequences from many |
pasteseq | Insert one sequence into another |
revseq | Reverse and complement a nucleotide sequence |
seqcount | Read and count sequences |
seqret | Read and write (return) sequences |
seqretsetall | Read and write (return) many sets of sequences |
seqretsplit | Read sequences and write them to individual files |
sizeseq | Sort sequences by size |
skipredundant | Remove redundant sequences from an input set |
skipseq | Read and write (return) sequences, skipping first few |
splitsource | Split sequence(s) into original source sequences |
splitter | Split sequence(s) into smaller sequences |
trimest | Remove poly-A tails from nucleotide sequences |
trimseq | Remove unwanted characters from start and end of sequence(s) |
trimspace | Remove extra whitespace from an ASCII text file |
union | Concatenate multiple sequences into a single sequence |
vectorstrip | Remove vectors from the ends of nucleotide sequence(s) |
yank | Add a sequence reference (a full USA) to a list file |
Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author.