nospace

 

Wiki

The master copies of EMBOSS documentation are available at http://emboss.open-bio.org/wiki/Appdocs on the EMBOSS Wiki.

Please help by correcting and extending the Wiki pages.

Function

Remove whitespace from an ASCII text file

Description

Removes all whitespace from the input sequence. trimspace replaces all white space with a single space.

Usage

Here is a sample session with nospace


% nospace 
Remove whitespace from an ASCII text file
ASCII text file: seqspace.txt
ASCII text output file [seqspace.nospace]: 

Go to the input files for this example
Go to the output files for this example

Command line arguments

Remove whitespace from an ASCII text file
Version: EMBOSS:6.5.0.0

   Standard (Mandatory) qualifiers:
  [-infile]            infile     ASCII text file
  [-outfile]           outfile    [*.nospace] ASCII text output file

   Additional (Optional) qualifiers:
   -menu               menu       [all] Remove whitespace (Values: all (all
                                  whitespace); end (trailing whitespace);
                                  excess (multiple whitespace characters))

   Advanced (Unprompted) qualifiers: (none)
   Associated qualifiers:

   "-outfile" associated qualifiers
   -odirectory2        string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write first file to standard output
   -filter             boolean    Read first file from standard input, write
                                  first file to standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options and exit. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages
   -version            boolean    Report version number and exit

Qualifier Type Description Allowed values Default
Standard (Mandatory) qualifiers
[-infile]
(Parameter 1)
infile ASCII text file Input file Required
[-outfile]
(Parameter 2)
outfile ASCII text output file Output file <*>.nospace
Additional (Optional) qualifiers
-menu list Remove whitespace
all (all whitespace)
end (trailing whitespace)
excess (multiple whitespace characters)
all
Advanced (Unprompted) qualifiers
(none)
Associated qualifiers
"-outfile" associated outfile qualifiers
-odirectory2
-odirectory_outfile
string Output directory Any string  
General qualifiers
-auto boolean Turn off prompts Boolean value Yes/No N
-stdout boolean Write first file to standard output Boolean value Yes/No N
-filter boolean Read first file from standard input, write first file to standard output Boolean value Yes/No N
-options boolean Prompt for standard and additional values Boolean value Yes/No N
-debug boolean Write debug output to program.dbg Boolean value Yes/No N
-verbose boolean Report some/full command line options Boolean value Yes/No Y
-help boolean Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose Boolean value Yes/No N
-warning boolean Report warnings Boolean value Yes/No Y
-error boolean Report errors Boolean value Yes/No Y
-fatal boolean Report fatal errors Boolean value Yes/No Y
-die boolean Report dying program messages Boolean value Yes/No Y
-version boolean Report version number and exit Boolean value Yes/No N

Input file format

nospace reads any text file.

Input files for usage example

File: seqspace.txt

>X13776
 ggtaccgctg gccgagcatc tgctcgatca ccaccagccg ggcgacggga
 actgcacgat ctacctggcg agcctggagc acgagcgggt tcgcttcgta
 cggcgctgag cgacagtcac aggagaggaa acggatggga tcgcaccagg
 agcggccgct gatcggcctg ctgttctccg aaaccggcgt caccgccgat
 atcgagcgct cgcacgcgta tggcgcattg ctcgcggtcg agcaactgaa
 ccgcgagggc ggcgtcggcg gtcgcccgat cgaaacgctg tcccaggacc
 ccggcggcga cccggaccgc tatcggctgt gcgccgagga cttcattcgc
 aaccgggggg tacggttcct cgtgggctgc tacatgtcgc acacgcgcaa
 ggcggtgatg ccggtggtcg agcgcgccga cgcgctgctc tgctacccga
 ccccctacga gggcttcgag tattcgccga acatcgtcta cggcggtccg
 gcgccgaacc agaacagtgc gccgctggcg gcgtacctga ttcgccacta
 cggcgagcgg gtggtgttca tcggctcgga ctacatctat ccgcgggaaa
 gcaaccatgt gatgcgccac ctgtatcgcc agcacggcgg cacggtgctc
 gaggaaatct acattccgct gtatccctcc gacgacgact tgcagcgcgc
 cgtcgagcgc atctaccagg cgcgcgccga cgtggtcttc tccaccgtgg
 tgggcaccgg caccgccgag ctgtatcgcg ccatcgcccg tcgctacggc
 gacggcaggc ggccgccgat cgccagcctg accaccagcg aggcggaggt
 ggcgaagatg gagagtgacg tggcagaggg gcaggtggtg gtcgcgcctt
 acttctccag catcgatacg cccgccagcc gggccttcgt ccaggcctgc
 catggtttct tcccggagaa cgcgaccatc accgcctggg ccgaggcggc
 ctactggcag accttgttgc tcggccgcgc cgcgcaggcc gcaggcaact
 ggcgggtgga agacgtgcag cggcacctgt acgacatcga catcgacgcg
 ccacaggggc cggtccgggt ggagcgccag aacaaccaca gccgcctgtc
 ttcgcgcatc gcggaaatcg atgcgcgcgg cgtgttccag gtccgctggc
 agtcgcccga accgattcgc cccgaccctt atgtcgtcgt gcataacctc
 gacgactggt ccgccagcat gggcggggga ccgctcccat gagcgccaac
 tcgctgctcg gcagcctgcg cgagttgcag gtgctggtcc tcaacccgcc
 gggggaggtc agcgacgccc tggtcttgca gctgatccgc atcggttgtt
 cggtgcgcca gtgctggccg ccgccggaag ccttcgacgt gccggtggac
 gtggtcttca ccagcatttt ccagaatggc caccacgacg agatcgctgc
 gctgctcgcc gccgggactc cgcgcactac cctggtggcg ctggtggagt
 acgaaagccc cgcggtgctc tcgcagatca tcgagctgga gtgccacggc
 gtgatcaccc agccgctcga tgcccaccgg gtgctgcctg tgctggtatc
 ggcgcggcgc atcagcgagg aaatggcgaa gctgaagcag aagaccgagc
 agctccagga ccgcatcgcc ggccaggccc ggatcaacca ggccaaggtg
 ttgctgatgc agcgccatgg ctgggacgag cgcgaggcgc accagcacct
 gtcgcgggaa gcgatgaagc ggcgcgagcc gatcctgaag atcgctcagg
 agttgctggg aaacgagccg tccgcctgag cgatccgggc cgaccagaac
 aataacaaga ggggtatcgt catcatgctg ggactggttc tgctgtacgt
 tggcgcggtg ctgtttctca atgccgtctg gttgctgggc aagatcagcg
 gtcgggaggt ggcggtgatc aacttcctgg tcggcgtgct gagcgcctgc
 gtcgcgttct acctgatctt ttccgcagca gccgggcagg gctcgctgaa
 ggccggagcg ctgaccctgc tattcgcttt tacctatctg tgggtggccg
 ccaaccagtt cctcgag

Output file format

nospace rewrites the input file.

Output files for usage example

File: seqspace.nospace

>X13776
ggtaccgctggccgagcatctgctcgatcaccaccagccgggcgacggga
actgcacgatctacctggcgagcctggagcacgagcgggttcgcttcgta
cggcgctgagcgacagtcacaggagaggaaacggatgggatcgcaccagg
agcggccgctgatcggcctgctgttctccgaaaccggcgtcaccgccgat
atcgagcgctcgcacgcgtatggcgcattgctcgcggtcgagcaactgaa
ccgcgagggcggcgtcggcggtcgcccgatcgaaacgctgtcccaggacc
ccggcggcgacccggaccgctatcggctgtgcgccgaggacttcattcgc
aaccggggggtacggttcctcgtgggctgctacatgtcgcacacgcgcaa
ggcggtgatgccggtggtcgagcgcgccgacgcgctgctctgctacccga
ccccctacgagggcttcgagtattcgccgaacatcgtctacggcggtccg
gcgccgaaccagaacagtgcgccgctggcggcgtacctgattcgccacta
cggcgagcgggtggtgttcatcggctcggactacatctatccgcgggaaa
gcaaccatgtgatgcgccacctgtatcgccagcacggcggcacggtgctc
gaggaaatctacattccgctgtatccctccgacgacgacttgcagcgcgc
cgtcgagcgcatctaccaggcgcgcgccgacgtggtcttctccaccgtgg
tgggcaccggcaccgccgagctgtatcgcgccatcgcccgtcgctacggc
gacggcaggcggccgccgatcgccagcctgaccaccagcgaggcggaggt
ggcgaagatggagagtgacgtggcagaggggcaggtggtggtcgcgcctt
acttctccagcatcgatacgcccgccagccgggccttcgtccaggcctgc
catggtttcttcccggagaacgcgaccatcaccgcctgggccgaggcggc
ctactggcagaccttgttgctcggccgcgccgcgcaggccgcaggcaact
ggcgggtggaagacgtgcagcggcacctgtacgacatcgacatcgacgcg
ccacaggggccggtccgggtggagcgccagaacaaccacagccgcctgtc
ttcgcgcatcgcggaaatcgatgcgcgcggcgtgttccaggtccgctggc
agtcgcccgaaccgattcgccccgacccttatgtcgtcgtgcataacctc
gacgactggtccgccagcatgggcgggggaccgctcccatgagcgccaac
tcgctgctcggcagcctgcgcgagttgcaggtgctggtcctcaacccgcc
gggggaggtcagcgacgccctggtcttgcagctgatccgcatcggttgtt
cggtgcgccagtgctggccgccgccggaagccttcgacgtgccggtggac
gtggtcttcaccagcattttccagaatggccaccacgacgagatcgctgc
gctgctcgccgccgggactccgcgcactaccctggtggcgctggtggagt
acgaaagccccgcggtgctctcgcagatcatcgagctggagtgccacggc
gtgatcacccagccgctcgatgcccaccgggtgctgcctgtgctggtatc
ggcgcggcgcatcagcgaggaaatggcgaagctgaagcagaagaccgagc
agctccaggaccgcatcgccggccaggcccggatcaaccaggccaaggtg
ttgctgatgcagcgccatggctgggacgagcgcgaggcgcaccagcacct
gtcgcgggaagcgatgaagcggcgcgagccgatcctgaagatcgctcagg
agttgctgggaaacgagccgtccgcctgagcgatccgggccgaccagaac
aataacaagaggggtatcgtcatcatgctgggactggttctgctgtacgt
tggcgcggtgctgtttctcaatgccgtctggttgctgggcaagatcagcg
gtcgggaggtggcggtgatcaacttcctggtcggcgtgctgagcgcctgc
gtcgcgttctacctgatcttttccgcagcagccgggcagggctcgctgaa
ggccggagcgctgaccctgctattcgcttttacctatctgtgggtggccg
ccaaccagttcctcgag

Data files

None.

Notes

None.

References

None.

Warnings

None.

Diagnostic Error Messages

None.

Exit status

It always exits with status 0.

Known bugs

None.

See also

Program name Description
aligncopy Read and write alignments
aligncopypair Read and write pairs from alignments
biosed Replace or delete sequence sections
codcopy Copy and reformat a codon usage table
cutseq Remove a section from a sequence
degapseq Remove non-alphabetic (e.g. gap) characters from sequences
descseq Alter the name or description of a sequence
entret Retrieve sequence entries from flatfile databases and files
extractalign Extract regions from a sequence alignment
extractfeat Extract features from sequence(s)
extractseq Extract regions from a sequence
featcopy Read and write a feature table
featmerge Merge two overlapping feature tables
featreport Read and write a feature table
feattext Return a feature table original text
listor Write a list file of the logical OR of two sets of sequences
makenucseq Create random nucleotide sequences
makeprotseq Create random protein sequences
maskambignuc Mask all ambiguity characters in nucleotide sequences with N
maskambigprot Mask all ambiguity characters in protein sequences with X
maskfeat Write a sequence with masked features
maskseq Write a sequence with masked regions
newseq Create a sequence file from a typed-in sequence
nohtml Remove mark-up (e.g. HTML tags) from an ASCII text file
noreturn Remove carriage return from ASCII files
notab Replace tabs with spaces in an ASCII text file
notseq Write to file a subset of an input stream of sequences
nthseq Write to file a single sequence from an input stream of sequences
nthseqset Read and write (return) one set of sequences from many
pasteseq Insert one sequence into another
revseq Reverse and complement a nucleotide sequence
seqcount Read and count sequences
seqret Read and write (return) sequences
seqretsetall Read and write (return) many sets of sequences
seqretsplit Read sequences and write them to individual files
sizeseq Sort sequences by size
skipredundant Remove redundant sequences from an input set
skipseq Read and write (return) sequences, skipping first few
splitsource Split sequence(s) into original source sequences
splitter Split sequence(s) into smaller sequences
trimest Remove poly-A tails from nucleotide sequences
trimseq Remove unwanted characters from start and end of sequence(s)
trimspace Remove extra whitespace from an ASCII text file
union Concatenate multiple sequences into a single sequence
vectorstrip Remove vectors from the ends of nucleotide sequence(s)
yank Add a sequence reference (a full USA) to a list file

Author(s)

Jon Ison
European Bioinformatics Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge CB10 1SD, UK

Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author.

History

Target users

This program is intended to be used by everyone and everything, from naive users to embedded scripts.

Comments

None