![]() |
vrnaalifold |
Please help by correcting and extending the Wiki pages.
This is a port of the Vienna RNA package program RNAalifold.
It reads aligned RNA sequences and calculates their minimum free energy (mfe) structure. It returns the mfe structure in bracket notation, its energy, the free energy of the thermodynamic ensemble and the frequency of the mfe structure in the ensemble. It also produces plots of the resulting secondary structure graph and a "dot plot" of the base pairing matrix.
The original program produces different outputs, depending on the options selected. In the EMBASSY implementation it is split into vrnaalifold and vrnaalifoldpf
% vrnaalifold Calculate secondary structures for a set of aligned RNAs Input (aligned) nucleotide sequence set: ecoli6s.fasta Vienna RNAfold output file [ecoli6s.vrnaalifold]: |
Go to the input files for this example
Go to the output files for this example
Calculate secondary structures for a set of aligned RNAs Version: EMBOSS:6.5.0.0 Standard (Mandatory) qualifiers: [-sequence] seqset (Aligned) nucleotide sequence set filename and optional format, or reference (input USA) [-outfile] outfile [*.vrnaalifold] Vienna RNAfold output file Additional (Optional) qualifiers: (none) Advanced (Unprompted) qualifiers: -constraintfile infile Vienna RNA structure constraints file (optional) -paramfile infile Vienna RNA parameters file (optional) -rsumfile infile Vienna RNA Ribosum file (optional) -temperature float [37.0] Temperature (Any numeric value) -[no]gu boolean [Y] Allow GU pairs -[no]closegu boolean [Y] Allow GU pairs at end of helices -[no]lp boolean [Y] Allow lonely pairs -[no]convert boolean [Y] Convert T to U -nsbases string Non-standard bases (Any string) -[no]tetraloop boolean [Y] Stabilizing energies for tetra-loops -circular boolean [N] Circular RNA -colour boolean [N] Colour structure plot -[no]alnps boolean [Y] Produce alignment postscript -energy menu [0] Rarely used option to fold sequences from the ABCD... alphabet (Values: 0 (BP); 1 (Any with GC); 2 (Any with AU parameters)) -scale float [1.07] Estimate of ensemble free energy (Any numeric value) -dangles menu [2] Method (Values: 0 (Ignore); 1 (Only unpaired bases for just one dangling end); 2 (Always use dangling energies); 3 (Allow coaxial stacking of adjacent helices)) -covariance float [1.0] Weight for covariance (Any numeric value) -nspenalty float [1.0] Non-compatible sequence penalty (Any numeric value) -endgaps boolean [N] Mark end gaps -most boolean [N] Use most informative sequence algorithm -ribosumscore boolean [N] Use ribosum scoring matrix -old boolean [N] Use old energy evaluation (gaps as chars) -ssoutfile outfile [*.vrnaalifold] Vienna RNA structure postscript output file -alignoutfile outfile [*.vrnaalifold] Vienna RNA alignment postscript output file Associated qualifiers: "-sequence" associated qualifiers -sbegin1 integer Start of each sequence to be used -send1 integer End of each sequence to be used -sreverse1 boolean Reverse (if DNA) -sask1 boolean Ask for begin/end/reverse -snucleotide1 boolean Sequence is nucleotide -sprotein1 boolean Sequence is protein -slower1 boolean Make lower case -supper1 boolean Make upper case -scircular1 boolean Sequence is circular -sformat1 string Input sequence format -iquery1 string Input query fields or ID list -ioffset1 integer Input start position offset -sdbname1 string Database name -sid1 string Entryname -ufo1 string UFO features -fformat1 string Features format -fopenfile1 string Features file name "-outfile" associated qualifiers -odirectory2 string Output directory "-ssoutfile" associated qualifiers -odirectory string Output directory "-alignoutfile" associated qualifiers -odirectory string Output directory General qualifiers: -auto boolean Turn off prompts -stdout boolean Write first file to standard output -filter boolean Read first file from standard input, write first file to standard output -options boolean Prompt for standard and additional values -debug boolean Write debug output to program.dbg -verbose boolean Report some/full command line options -help boolean Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose -warning boolean Report warnings -error boolean Report errors -fatal boolean Report fatal errors -die boolean Report dying program messages -version boolean Report version number and exit |
Qualifier | Type | Description | Allowed values | Default | ||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
Standard (Mandatory) qualifiers | ||||||||||||
[-sequence] (Parameter 1) |
seqset | (Aligned) nucleotide sequence set filename and optional format, or reference (input USA) | Readable set of sequences | Required | ||||||||
[-outfile] (Parameter 2) |
outfile | Vienna RNAfold output file | Output file | <*>.vrnaalifold | ||||||||
Additional (Optional) qualifiers | ||||||||||||
(none) | ||||||||||||
Advanced (Unprompted) qualifiers | ||||||||||||
-constraintfile | infile | Vienna RNA structure constraints file (optional) | Input file | Required | ||||||||
-paramfile | infile | Vienna RNA parameters file (optional) | Input file | Required | ||||||||
-rsumfile | infile | Vienna RNA Ribosum file (optional) | Input file | Required | ||||||||
-temperature | float | Temperature | Any numeric value | 37.0 | ||||||||
-[no]gu | boolean | Allow GU pairs | Boolean value Yes/No | Yes | ||||||||
-[no]closegu | boolean | Allow GU pairs at end of helices | Boolean value Yes/No | Yes | ||||||||
-[no]lp | boolean | Allow lonely pairs | Boolean value Yes/No | Yes | ||||||||
-[no]convert | boolean | Convert T to U | Boolean value Yes/No | Yes | ||||||||
-nsbases | string | Non-standard bases | Any string | |||||||||
-[no]tetraloop | boolean | Stabilizing energies for tetra-loops | Boolean value Yes/No | Yes | ||||||||
-circular | boolean | Circular RNA | Boolean value Yes/No | No | ||||||||
-colour | boolean | Colour structure plot | Boolean value Yes/No | No | ||||||||
-[no]alnps | boolean | Produce alignment postscript | Boolean value Yes/No | Yes | ||||||||
-energy | list | Rarely used option to fold sequences from the ABCD... alphabet |
|
0 | ||||||||
-scale | float | Estimate of ensemble free energy | Any numeric value | 1.07 | ||||||||
-dangles | list | Method |
|
2 | ||||||||
-covariance | float | Weight for covariance | Any numeric value | 1.0 | ||||||||
-nspenalty | float | Non-compatible sequence penalty | Any numeric value | 1.0 | ||||||||
-endgaps | boolean | Mark end gaps | Boolean value Yes/No | No | ||||||||
-most | boolean | Use most informative sequence algorithm | Boolean value Yes/No | No | ||||||||
-ribosumscore | boolean | Use ribosum scoring matrix | Boolean value Yes/No | No | ||||||||
-old | boolean | Use old energy evaluation (gaps as chars) | Boolean value Yes/No | No | ||||||||
-ssoutfile | outfile | Vienna RNA structure postscript output file | Output file | <*>.vrnaalifold | ||||||||
-alignoutfile | outfile | Vienna RNA alignment postscript output file | Output file | <*>.vrnaalifold | ||||||||
Associated qualifiers | ||||||||||||
"-sequence" associated seqset qualifiers | ||||||||||||
-sbegin1 -sbegin_sequence |
integer | Start of each sequence to be used | Any integer value | 0 | ||||||||
-send1 -send_sequence |
integer | End of each sequence to be used | Any integer value | 0 | ||||||||
-sreverse1 -sreverse_sequence |
boolean | Reverse (if DNA) | Boolean value Yes/No | N | ||||||||
-sask1 -sask_sequence |
boolean | Ask for begin/end/reverse | Boolean value Yes/No | N | ||||||||
-snucleotide1 -snucleotide_sequence |
boolean | Sequence is nucleotide | Boolean value Yes/No | N | ||||||||
-sprotein1 -sprotein_sequence |
boolean | Sequence is protein | Boolean value Yes/No | N | ||||||||
-slower1 -slower_sequence |
boolean | Make lower case | Boolean value Yes/No | N | ||||||||
-supper1 -supper_sequence |
boolean | Make upper case | Boolean value Yes/No | N | ||||||||
-scircular1 -scircular_sequence |
boolean | Sequence is circular | Boolean value Yes/No | N | ||||||||
-sformat1 -sformat_sequence |
string | Input sequence format | Any string | |||||||||
-iquery1 -iquery_sequence |
string | Input query fields or ID list | Any string | |||||||||
-ioffset1 -ioffset_sequence |
integer | Input start position offset | Any integer value | 0 | ||||||||
-sdbname1 -sdbname_sequence |
string | Database name | Any string | |||||||||
-sid1 -sid_sequence |
string | Entryname | Any string | |||||||||
-ufo1 -ufo_sequence |
string | UFO features | Any string | |||||||||
-fformat1 -fformat_sequence |
string | Features format | Any string | |||||||||
-fopenfile1 -fopenfile_sequence |
string | Features file name | Any string | |||||||||
"-outfile" associated outfile qualifiers | ||||||||||||
-odirectory2 -odirectory_outfile |
string | Output directory | Any string | |||||||||
"-ssoutfile" associated outfile qualifiers | ||||||||||||
-odirectory | string | Output directory | Any string | |||||||||
"-alignoutfile" associated outfile qualifiers | ||||||||||||
-odirectory | string | Output directory | Any string | |||||||||
General qualifiers | ||||||||||||
-auto | boolean | Turn off prompts | Boolean value Yes/No | N | ||||||||
-stdout | boolean | Write first file to standard output | Boolean value Yes/No | N | ||||||||
-filter | boolean | Read first file from standard input, write first file to standard output | Boolean value Yes/No | N | ||||||||
-options | boolean | Prompt for standard and additional values | Boolean value Yes/No | N | ||||||||
-debug | boolean | Write debug output to program.dbg | Boolean value Yes/No | N | ||||||||
-verbose | boolean | Report some/full command line options | Boolean value Yes/No | Y | ||||||||
-help | boolean | Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose | Boolean value Yes/No | N | ||||||||
-warning | boolean | Report warnings | Boolean value Yes/No | Y | ||||||||
-error | boolean | Report errors | Boolean value Yes/No | Y | ||||||||
-fatal | boolean | Report fatal errors | Boolean value Yes/No | Y | ||||||||
-die | boolean | Report dying program messages | Boolean value Yes/No | Y | ||||||||
-version | boolean | Report version number and exit | Boolean value Yes/No | N |
>X01238.1/1-183 AUUUCUCUGAGAUGUUCGCAAGCGGGC.CAGUCCCCUGAGCCGAUAUUUCAUACCACAAG AAUGUGGCGCUCCGCGGUUGGUGAGCAUGCUCGGUCCGU...............CCGAGA AGCCUUAAAACUGCGACGACACAUUCACCUUGAACCAA.GGGUUCAAGGGUUACAGCCUG CGGCGGCA.UC.UCGGAG.AUUC >AL627277.1/108623-108805 AUUUCUCUGAGAUGUUUGCAAGCGGGC.CAGUCCCCUGAGCCGAUAUUUCAUACCACAAG AAUGUGGCGCUCCGCGGUUGGUGAGCAUGCUCGGUUCGU...............CCGAGA AGCCUUAAAACUGUGACGACACAUUCACCUUGAACCAA.GGGUUCAAGGGUUACAGCCUG CGGCGGCA.UC.UCGGAG.AUUC >AJ414145.1/90993-91174 AUUUCUCUGAGGUGUUUGCCAGCGGGC.CAGUCCCCUGAGCCGAUAUUUAAUACCAACAG AAUGUAGUGCUCCGUAACCGGUGAGCAUGCUCGGUCCG................CCGAGA AGCCUUAAGGUUGCGACGCUGCGUUCACCUUGAACCAA.GGGUUCAAGGGUUACAGCCUG CGACGGCA.CC.UCGGAG.AUCC >U32767.1/6538-6734 .AUUACCUGGAGUGUUCGUCAGUAGGC.UAUGUCCCUGAGCCGAUACUUUAAAUCUUAUA AAUU.GGUUUCCUAUCGUUGGUGUGUAGGCUUAACCUUUGACUCGUUCAUUGGGCUAAGA AACCUGAAAACGGUAUCAACUGAUUU.CCUUGAACCGUCGGGUUCAAGGACUACUGCCCG CAGCGGCACUC.UGGGGU.CUUC >AE006208.1/8365-8185 .AUUACCUGAGGUGUUUGCCAGUGGGU.UAUGUCCCUGAGCCGAUACUUU.UAUUUUAUG AAUC.GGUUUCUAAUUGUUGGUGUGCAUGCUUAGCUUGA...............CUAAGA AGCCUAAAAAUAGUUAUAACUGAUUC.CCUUGAACCGUUGGGUUCAAGGACUGAGACUUG CAGCGGCA.UC.UCGGGUUCUUC >Y00334.1/77-254 CGCUCCCUGGUGUGUUGGCCAGUCGGU.GAUGUCCCUGAGCCGAUAACUGCAACAAC..G GAGGUUGC.CAGUUGGACCGGUGUGCAUGUCCGCACG.................ACGGAA AGCCUUAAGGUCUAC.UGCAACCGCCACCUUGAACUUUCGGGUUCAAGGGCUA.ACCCGA CAGCGGCA.CGACCGGGG.AGCU >AE004317.1/5626-5807 UUUACCCUGGGGUGUUCGUCAGCGGAUUUAUGUCCCUGAGCCGAUAAGCAACAUAAC..A GGGUUGGUAUUGGGUAGCUAUUGAGCAAGCUCGGCUUGUA..............CCGAGA AGCCUGCGGUUACCAUUACUGAUCCG.CCUUGAACCUGAUGGUUCAAGGGCUACGAUCCU CAACGGCA.UC.CCGGGG.UUC. |
AUUUCCCUGAGGUGUUCGCCAGCGGGC_CAUGUCCCUGAGCCGAUAUUUAAUACCACAAGAAUGUGGUGCUCCGUGGUUGGUGAGCAUGCUCGGCCCGU_______________CCGAGAAGCCUUAAAAUUGCGACGACACAUUCACCUUGAACCAA_GGGUUCAAGGGCUACAGCCUGCAGCGGCA_UC_UCGGGG_AUUC ...((((((((((((.(((..((((((................................(((((((......(((((((.....((...(((((....................)))))..)).....)))))))....))))))).(((((((((....)))))))))......)))))).)))))).)).)))))).)... (-65.91 = -57.83 + -8.08) |
Program name | Description |
---|---|
banana | Plot bending and curvature data for B-DNA |
btwisted | Calculate the twisting in a B-DNA sequence |
einverted | Find inverted repeats in nucleotide sequences |
ovrnaalifold | Calculate secondary structures for a set of aligned RNAs |
ovrnaalifoldpf | Calculate secondary structures for a set of aligned RNAs (partition) |
ovrnacofold | Calculate secondary structures of RNA dimers |
ovrnacofoldconc | Calculate secondary structures of RNA dimers (concentrations) |
ovrnacofoldpf | Calculate secondary structures of RNA dimers (partitioning) |
ovrnadistance | Calculate distances between RNA secondary structures |
ovrnaduplex | Predict RNA duplex (hybridization) sites and structure |
ovrnaeval | Calculate energy of RNA sequences with a given secondary structure |
ovrnaevalpair | Calculate energy of RNA sequences on given secondary structure |
ovrnafold | Calculate min. energy RNA structure / pair probabilities (partition) |
ovrnafoldpf | Calculate min. energy RNA structure / pair probabilities |
ovrnaheat | Calculate specific heat of RNA melting |
ovrnainverse | Find RNA sequences with a given secondary structure |
ovrnalfold | Calculate locally stable secondary structures of RNAs |
ovrnaplot | Draw RNA secondary structures |
ovrnasubopt | Calculate suboptimal secondary structure of RNA |
sirna | Find siRNA duplexes in mRNA |
vrna2dfold | Calculate RNA structures and samples of k,l neighbourhoods |
vrnaaliduplex | RNA duplex calculation for two sequence alignments |
vrnaalifoldpf | Calculate secondary structures for a set of aligned RNAs (partition) |
vrnacofold | Calculate secondary structures of RNA dimers |
vrnacofoldconc | Calculate secondary structures of RNA dimers (concentrations) |
vrnacofoldpf | Calculate secondary structures of RNA dimers (partitioning) |
vrnadistance | Calculate distances between RNA secondary structures |
vrnaduplex | Predict RNA duplex (hybridization) sites and structure |
vrnaeval | Calculate energy of RNA sequences with a given secondary structure |
vrnaevalpair | Calculate energy of RNA sequences on given secondary structure |
vrnafold | Calculate min. energy RNA secondary structures and pair probabilities |
vrnafoldpf | Calculate min. energy RNA structures / pair probabilities (partition) |
vrnaheat | Calculate specific heat of RNA melting |
vrnainverse | Find RNA sequences with a given secondary structure |
vrnalalifoldpf | Calculate secondary structures for a set of aligned RNAs (partition) |
vrnalfold | Calculate locally stable secondary structures of RNAs |
vrnalfoldz | Calculate locally stable secondary structures of RNAs plus zscore |
vrnapkplex | Calculate RNA structures plus pseudoknots |
vrnaplfold | Compute avg. pair probabilities for local base pairs in RNA sequences |
vrnaplot | Draw RNA secondary structures |
vrnasubopt | Calculate suboptimal secondary structures of RNAs |
Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author.