ovrnafold

 

Wiki

The master copies of EMBOSS documentation are available at http://emboss.open-bio.org/wiki/Appdocs on the EMBOSS Wiki.

Please help by correcting and extending the Wiki pages.

Function

Calculate min. energy RNA structure / pair probabilities (partition)

Description

This is a port of the Vienna RNA package program RNAfold.

It reads RNA sequences, calculates their minimum free energy (mfe) structure and output the mfe structure in bracket notation and its free energy. It produces plots of the resulting secondary structure graph and a "dot plot" of the base pairing matrix.

The original program has additional inputs and produces different outputs, depending on the options selected. In the EMBASSY implementation it is split into ovrnafold for a single sequence and ovrnafoldpf for a pair of sequences

Algorithm

See the original documentation for the Vienna RNA package http://www.tbi.univie.ac.at/~ivo/RNA/

Usage

Here is a sample session with ovrnafold


% ovrnafold -constraintfile rna1.fold 
Calculate min. energy RNA structure / pair probabilities (partition)
Input nucleotide sequence: rna1.seq
Vienna RNAfold output file [rna1.ovrnafold]: 

Go to the input files for this example
Go to the output files for this example

Example 2


% ovrnafold 
Calculate min. energy RNA structure / pair probabilities (partition)
Input nucleotide sequence: rna1.seq
Vienna RNAfold output file [rna1.ovrnafold]: 

Go to the output files for this example

Command line arguments

Calculate min. energy RNA structure / pair probabilities (partition)
Version: EMBOSS:6.5.0.0

   Standard (Mandatory) qualifiers:
  [-sequence]          sequence   Nucleotide sequence filename and optional
                                  format, or reference (input USA)
  [-outfile]           outfile    [*.ovrnafold] Vienna RNAfold output file

   Additional (Optional) qualifiers: (none)
   Advanced (Unprompted) qualifiers:
   -constraintfile     infile     Vienna RNA structure constraints file
                                  (optional)
   -paramfile          infile     Vienna RNA parameters file (optional)
   -temperature        float      [37.0] Temperature (Any numeric value)
   -circular           boolean    [N] Allow circular RNA
   -[no]gu             boolean    [Y] Allow GU pairs
   -[no]closegu        boolean    [Y] Allow GU pairs at end of helices
   -[no]lp             boolean    [Y] Allow lonely pairs
   -[no]convert        boolean    [Y] Convert T to U
   -nsbases            string     Non-standard bases (Any string)
   -[no]tetraloop      boolean    [Y] Stabilizing energies for tetra-loops
   -energy             menu       [0] Rarely used option to fold sequences
                                  from the ABCD... alphabet (Values: 0 (BP); 1
                                  (Any with GC); 2 (Any with AU parameters))
   -scale              float      [1.07] Estimate of ensemble free energy (Any
                                  numeric value)
   -dangles            menu       [1] Method (Values: 0 (Ignore); 1 (Only
                                  unpaired bases for just one dangling end); 2
                                  (Always use dangling energies); 3 (Allow
                                  coaxial stacking of adjacent helices))
   -ssoutfile          outfile    [*.ovrnafold] Vienna RNA structure
                                  postscript output file

   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin1            integer    Start of the sequence to be used
   -send1              integer    End of the sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -scircular1         boolean    Sequence is circular
   -sformat1           string     Input sequence format
   -iquery1            string     Input query fields or ID list
   -ioffset1           integer    Input start position offset
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name

   "-outfile" associated qualifiers
   -odirectory2        string     Output directory

   "-ssoutfile" associated qualifiers
   -odirectory         string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write first file to standard output
   -filter             boolean    Read first file from standard input, write
                                  first file to standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options and exit. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages
   -version            boolean    Report version number and exit

Qualifier Type Description Allowed values Default
Standard (Mandatory) qualifiers
[-sequence]
(Parameter 1)
sequence Nucleotide sequence filename and optional format, or reference (input USA) Readable sequence Required
[-outfile]
(Parameter 2)
outfile Vienna RNAfold output file Output file <*>.ovrnafold
Additional (Optional) qualifiers
(none)
Advanced (Unprompted) qualifiers
-constraintfile infile Vienna RNA structure constraints file (optional) Input file Required
-paramfile infile Vienna RNA parameters file (optional) Input file Required
-temperature float Temperature Any numeric value 37.0
-circular boolean Allow circular RNA Boolean value Yes/No No
-[no]gu boolean Allow GU pairs Boolean value Yes/No Yes
-[no]closegu boolean Allow GU pairs at end of helices Boolean value Yes/No Yes
-[no]lp boolean Allow lonely pairs Boolean value Yes/No Yes
-[no]convert boolean Convert T to U Boolean value Yes/No Yes
-nsbases string Non-standard bases Any string  
-[no]tetraloop boolean Stabilizing energies for tetra-loops Boolean value Yes/No Yes
-energy list Rarely used option to fold sequences from the ABCD... alphabet
0 (BP)
1 (Any with GC)
2 (Any with AU parameters)
0
-scale float Estimate of ensemble free energy Any numeric value 1.07
-dangles list Method
0 (Ignore)
1 (Only unpaired bases for just one dangling end)
2 (Always use dangling energies)
3 (Allow coaxial stacking of adjacent helices)
1
-ssoutfile outfile Vienna RNA structure postscript output file Output file <*>.ovrnafold
Associated qualifiers
"-sequence" associated sequence qualifiers
-sbegin1
-sbegin_sequence
integer Start of the sequence to be used Any integer value 0
-send1
-send_sequence
integer End of the sequence to be used Any integer value 0
-sreverse1
-sreverse_sequence
boolean Reverse (if DNA) Boolean value Yes/No N
-sask1
-sask_sequence
boolean Ask for begin/end/reverse Boolean value Yes/No N
-snucleotide1
-snucleotide_sequence
boolean Sequence is nucleotide Boolean value Yes/No N
-sprotein1
-sprotein_sequence
boolean Sequence is protein Boolean value Yes/No N
-slower1
-slower_sequence
boolean Make lower case Boolean value Yes/No N
-supper1
-supper_sequence
boolean Make upper case Boolean value Yes/No N
-scircular1
-scircular_sequence
boolean Sequence is circular Boolean value Yes/No N
-sformat1
-sformat_sequence
string Input sequence format Any string  
-iquery1
-iquery_sequence
string Input query fields or ID list Any string  
-ioffset1
-ioffset_sequence
integer Input start position offset Any integer value 0
-sdbname1
-sdbname_sequence
string Database name Any string  
-sid1
-sid_sequence
string Entryname Any string  
-ufo1
-ufo_sequence
string UFO features Any string  
-fformat1
-fformat_sequence
string Features format Any string  
-fopenfile1
-fopenfile_sequence
string Features file name Any string  
"-outfile" associated outfile qualifiers
-odirectory2
-odirectory_outfile
string Output directory Any string  
"-ssoutfile" associated outfile qualifiers
-odirectory string Output directory Any string  
General qualifiers
-auto boolean Turn off prompts Boolean value Yes/No N
-stdout boolean Write first file to standard output Boolean value Yes/No N
-filter boolean Read first file from standard input, write first file to standard output Boolean value Yes/No N
-options boolean Prompt for standard and additional values Boolean value Yes/No N
-debug boolean Write debug output to program.dbg Boolean value Yes/No N
-verbose boolean Report some/full command line options Boolean value Yes/No Y
-help boolean Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose Boolean value Yes/No N
-warning boolean Report warnings Boolean value Yes/No Y
-error boolean Report errors Boolean value Yes/No Y
-fatal boolean Report fatal errors Boolean value Yes/No Y
-die boolean Report dying program messages Boolean value Yes/No Y
-version boolean Report version number and exit Boolean value Yes/No N

Input file format

ovrnafold reads any normal sequence USAs.

Input files for usage example

File: rna1.fold

.((.......<<..........||............))..

File: rna1.seq

>rna1
CACUACUCCAAGGACCGUAUCUUUCUCAGUGCGACAGUAA

Output file format

ovrnafold outputs a graph to the specified graphics device. outputs a report format file. The default format is ...

Output files for usage example

Graphics File: rna1.ssps

[ovrnafold results]

File: rna1.ovrnafold

CACUACUCCAAGGACCGUAUCUUUCUCAGUGCGACAGUAA
...((((..(((((.....)))))...))))......... ( -2.20)

Output files for usage example 2

Graphics File: rna1.ssps

[ovrnafold results]

File: rna1.ovrnafold

CACUACUCCAAGGACCGUAUCUUUCUCAGUGCGACAGUAA
.(((..((....)).(((((........)))))..))).. ( -3.50)

Data files

For details of Vienna RNA file formats, see the original documentation http://www.tbi.univie.ac.at/~ivo/RNA/

Notes

None.

References

None.

Warnings

None.

Diagnostic Error Messages

None.

Exit status

It always exits with status 0.

Known bugs

None.

See also

Program name Description
banana Plot bending and curvature data for B-DNA
btwisted Calculate the twisting in a B-DNA sequence
einverted Find inverted repeats in nucleotide sequences
ovrnaalifold Calculate secondary structures for a set of aligned RNAs
ovrnaalifoldpf Calculate secondary structures for a set of aligned RNAs (partition)
ovrnacofold Calculate secondary structures of RNA dimers
ovrnacofoldconc Calculate secondary structures of RNA dimers (concentrations)
ovrnacofoldpf Calculate secondary structures of RNA dimers (partitioning)
ovrnadistance Calculate distances between RNA secondary structures
ovrnaduplex Predict RNA duplex (hybridization) sites and structure
ovrnaeval Calculate energy of RNA sequences with a given secondary structure
ovrnaevalpair Calculate energy of RNA sequences on given secondary structure
ovrnafoldpf Calculate min. energy RNA structure / pair probabilities
ovrnaheat Calculate specific heat of RNA melting
ovrnainverse Find RNA sequences with a given secondary structure
ovrnalfold Calculate locally stable secondary structures of RNAs
ovrnaplot Draw RNA secondary structures
ovrnasubopt Calculate suboptimal secondary structure of RNA
sirna Find siRNA duplexes in mRNA
vrna2dfold Calculate RNA structures and samples of k,l neighbourhoods
vrnaaliduplex RNA duplex calculation for two sequence alignments
vrnaalifold Calculate secondary structures for a set of aligned RNAs
vrnaalifoldpf Calculate secondary structures for a set of aligned RNAs (partition)
vrnacofold Calculate secondary structures of RNA dimers
vrnacofoldconc Calculate secondary structures of RNA dimers (concentrations)
vrnacofoldpf Calculate secondary structures of RNA dimers (partitioning)
vrnadistance Calculate distances between RNA secondary structures
vrnaduplex Predict RNA duplex (hybridization) sites and structure
vrnaeval Calculate energy of RNA sequences with a given secondary structure
vrnaevalpair Calculate energy of RNA sequences on given secondary structure
vrnafold Calculate min. energy RNA secondary structures and pair probabilities
vrnafoldpf Calculate min. energy RNA structures / pair probabilities (partition)
vrnaheat Calculate specific heat of RNA melting
vrnainverse Find RNA sequences with a given secondary structure
vrnalalifoldpf Calculate secondary structures for a set of aligned RNAs (partition)
vrnalfold Calculate locally stable secondary structures of RNAs
vrnalfoldz Calculate locally stable secondary structures of RNAs plus zscore
vrnapkplex Calculate RNA structures plus pseudoknots
vrnaplfold Compute avg. pair probabilities for local base pairs in RNA sequences
vrnaplot Draw RNA secondary structures
vrnasubopt Calculate suboptimal secondary structures of RNAs

Author(s)

This program is an EMBOSS conversion of a program written by Ivo Hofacker as part of his VIENNA package.

Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author.

History

Converted (October 2005) by Alan Bleasby

Target users

This program is intended to be used by everyone and everything, from naive users to embedded scripts.

Comments