|
|
vrnapkplex |
Please help by correcting and extending the Wiki pages.
It also produces a PostScript file with a plot of the pseudoknot‐free secondary structure graph, in which the bases forming the pseuodknot are marked red.
% vrnapkplex Calculate RNA structures plus pseudoknots Input nucleotide sequence: rna1.seq Vienna RNAfold output file [rna1.vrnapkplex]: |
Go to the input files for this example
Go to the output files for this example
Calculate RNA structures plus pseudoknots
Version: EMBOSS:6.5.0.0
Standard (Mandatory) qualifiers:
[-sequence] sequence Nucleotide sequence filename and optional
format, or reference (input USA)
[-outfile] outfile [*.vrnapkplex] Vienna RNAfold output file
Additional (Optional) qualifiers: (none)
Advanced (Unprompted) qualifiers:
-paramfile infile Vienna RNA parameters file (optional)
-temperature float [37.0] Temperature (Any numeric value)
-[no]tetraloop boolean [Y] Stabilizing energies for tetra-loops
-[no]lp boolean [Y] Allow lonely pairs
-[no]gu boolean [Y] Allow GU pairs
-[no]closegu boolean [Y] Allow GU pairs at end of helices
-[no]convert boolean [Y] Convert T to U
-nsbases string Non-standard bases (Any string)
-cutoff float [0.01] Report only bp with avg prob > cutoff
(Any numeric value)
-energycutoff integer [-810] Pseudoknot initiation cost (Any
integer value)
-suboptimals integer [0] Energy difference from optimal for
subopt to be printed (Any integer value)
-extended boolean [N] Extended output
-ssoutfile outfile [*.vrnapkplex] Vienna RNA structure
postscript output file
Associated qualifiers:
"-sequence" associated qualifiers
-sbegin1 integer Start of the sequence to be used
-send1 integer End of the sequence to be used
-sreverse1 boolean Reverse (if DNA)
-sask1 boolean Ask for begin/end/reverse
-snucleotide1 boolean Sequence is nucleotide
-sprotein1 boolean Sequence is protein
-slower1 boolean Make lower case
-supper1 boolean Make upper case
-scircular1 boolean Sequence is circular
-sformat1 string Input sequence format
-iquery1 string Input query fields or ID list
-ioffset1 integer Input start position offset
-sdbname1 string Database name
-sid1 string Entryname
-ufo1 string UFO features
-fformat1 string Features format
-fopenfile1 string Features file name
"-outfile" associated qualifiers
-odirectory2 string Output directory
"-ssoutfile" associated qualifiers
-odirectory string Output directory
General qualifiers:
-auto boolean Turn off prompts
-stdout boolean Write first file to standard output
-filter boolean Read first file from standard input, write
first file to standard output
-options boolean Prompt for standard and additional values
-debug boolean Write debug output to program.dbg
-verbose boolean Report some/full command line options
-help boolean Report command line options and exit. More
information on associated and general
qualifiers can be found with -help -verbose
-warning boolean Report warnings
-error boolean Report errors
-fatal boolean Report fatal errors
-die boolean Report dying program messages
-version boolean Report version number and exit
|
| Qualifier | Type | Description | Allowed values | Default |
|---|---|---|---|---|
| Standard (Mandatory) qualifiers | ||||
| [-sequence] (Parameter 1) |
sequence | Nucleotide sequence filename and optional format, or reference (input USA) | Readable sequence | Required |
| [-outfile] (Parameter 2) |
outfile | Vienna RNAfold output file | Output file | <*>.vrnapkplex |
| Additional (Optional) qualifiers | ||||
| (none) | ||||
| Advanced (Unprompted) qualifiers | ||||
| -paramfile | infile | Vienna RNA parameters file (optional) | Input file | Required |
| -temperature | float | Temperature | Any numeric value | 37.0 |
| -[no]tetraloop | boolean | Stabilizing energies for tetra-loops | Boolean value Yes/No | Yes |
| -[no]lp | boolean | Allow lonely pairs | Boolean value Yes/No | Yes |
| -[no]gu | boolean | Allow GU pairs | Boolean value Yes/No | Yes |
| -[no]closegu | boolean | Allow GU pairs at end of helices | Boolean value Yes/No | Yes |
| -[no]convert | boolean | Convert T to U | Boolean value Yes/No | Yes |
| -nsbases | string | Non-standard bases | Any string | |
| -cutoff | float | Report only bp with avg prob > cutoff | Any numeric value | 0.01 |
| -energycutoff | integer | Pseudoknot initiation cost | Any integer value | -810 |
| -suboptimals | integer | Energy difference from optimal for subopt to be printed | Any integer value | 0 |
| -extended | boolean | Extended output | Boolean value Yes/No | No |
| -ssoutfile | outfile | Vienna RNA structure postscript output file | Output file | <*>.vrnapkplex |
| Associated qualifiers | ||||
| "-sequence" associated sequence qualifiers | ||||
| -sbegin1 -sbegin_sequence |
integer | Start of the sequence to be used | Any integer value | 0 |
| -send1 -send_sequence |
integer | End of the sequence to be used | Any integer value | 0 |
| -sreverse1 -sreverse_sequence |
boolean | Reverse (if DNA) | Boolean value Yes/No | N |
| -sask1 -sask_sequence |
boolean | Ask for begin/end/reverse | Boolean value Yes/No | N |
| -snucleotide1 -snucleotide_sequence |
boolean | Sequence is nucleotide | Boolean value Yes/No | N |
| -sprotein1 -sprotein_sequence |
boolean | Sequence is protein | Boolean value Yes/No | N |
| -slower1 -slower_sequence |
boolean | Make lower case | Boolean value Yes/No | N |
| -supper1 -supper_sequence |
boolean | Make upper case | Boolean value Yes/No | N |
| -scircular1 -scircular_sequence |
boolean | Sequence is circular | Boolean value Yes/No | N |
| -sformat1 -sformat_sequence |
string | Input sequence format | Any string | |
| -iquery1 -iquery_sequence |
string | Input query fields or ID list | Any string | |
| -ioffset1 -ioffset_sequence |
integer | Input start position offset | Any integer value | 0 |
| -sdbname1 -sdbname_sequence |
string | Database name | Any string | |
| -sid1 -sid_sequence |
string | Entryname | Any string | |
| -ufo1 -ufo_sequence |
string | UFO features | Any string | |
| -fformat1 -fformat_sequence |
string | Features format | Any string | |
| -fopenfile1 -fopenfile_sequence |
string | Features file name | Any string | |
| "-outfile" associated outfile qualifiers | ||||
| -odirectory2 -odirectory_outfile |
string | Output directory | Any string | |
| "-ssoutfile" associated outfile qualifiers | ||||
| -odirectory | string | Output directory | Any string | |
| General qualifiers | ||||
| -auto | boolean | Turn off prompts | Boolean value Yes/No | N |
| -stdout | boolean | Write first file to standard output | Boolean value Yes/No | N |
| -filter | boolean | Read first file from standard input, write first file to standard output | Boolean value Yes/No | N |
| -options | boolean | Prompt for standard and additional values | Boolean value Yes/No | N |
| -debug | boolean | Write debug output to program.dbg | Boolean value Yes/No | N |
| -verbose | boolean | Report some/full command line options | Boolean value Yes/No | Y |
| -help | boolean | Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose | Boolean value Yes/No | N |
| -warning | boolean | Report warnings | Boolean value Yes/No | Y |
| -error | boolean | Report errors | Boolean value Yes/No | Y |
| -fatal | boolean | Report fatal errors | Boolean value Yes/No | Y |
| -die | boolean | Report dying program messages | Boolean value Yes/No | Y |
| -version | boolean | Report version number and exit | Boolean value Yes/No | N |
>rna1 CACUACUCCAAGGACCGUAUCUUUCUCAGUGCGACAGUAA |
CACUACUCCAAGGACCGUAUCUUUCUCAGUGCGACAGUAA ...............(((((........)))))....... (5.10) |
| Program name | Description |
|---|---|
| banana | Plot bending and curvature data for B-DNA |
| btwisted | Calculate the twisting in a B-DNA sequence |
| einverted | Find inverted repeats in nucleotide sequences |
| ovrnaalifold | Calculate secondary structures for a set of aligned RNAs |
| ovrnaalifoldpf | Calculate secondary structures for a set of aligned RNAs (partition) |
| ovrnacofold | Calculate secondary structures of RNA dimers |
| ovrnacofoldconc | Calculate secondary structures of RNA dimers (concentrations) |
| ovrnacofoldpf | Calculate secondary structures of RNA dimers (partitioning) |
| ovrnadistance | Calculate distances between RNA secondary structures |
| ovrnaduplex | Predict RNA duplex (hybridization) sites and structure |
| ovrnaeval | Calculate energy of RNA sequences with a given secondary structure |
| ovrnaevalpair | Calculate energy of RNA sequences on given secondary structure |
| ovrnafold | Calculate min. energy RNA structure / pair probabilities (partition) |
| ovrnafoldpf | Calculate min. energy RNA structure / pair probabilities |
| ovrnaheat | Calculate specific heat of RNA melting |
| ovrnainverse | Find RNA sequences with a given secondary structure |
| ovrnalfold | Calculate locally stable secondary structures of RNAs |
| ovrnaplot | Draw RNA secondary structures |
| ovrnasubopt | Calculate suboptimal secondary structure of RNA |
| sirna | Find siRNA duplexes in mRNA |
| vrna2dfold | Calculate RNA structures and samples of k,l neighbourhoods |
| vrnaaliduplex | RNA duplex calculation for two sequence alignments |
| vrnaalifold | Calculate secondary structures for a set of aligned RNAs |
| vrnaalifoldpf | Calculate secondary structures for a set of aligned RNAs (partition) |
| vrnacofold | Calculate secondary structures of RNA dimers |
| vrnacofoldconc | Calculate secondary structures of RNA dimers (concentrations) |
| vrnacofoldpf | Calculate secondary structures of RNA dimers (partitioning) |
| vrnadistance | Calculate distances between RNA secondary structures |
| vrnaduplex | Predict RNA duplex (hybridization) sites and structure |
| vrnaeval | Calculate energy of RNA sequences with a given secondary structure |
| vrnaevalpair | Calculate energy of RNA sequences on given secondary structure |
| vrnafold | Calculate min. energy RNA secondary structures and pair probabilities |
| vrnafoldpf | Calculate min. energy RNA structures / pair probabilities (partition) |
| vrnaheat | Calculate specific heat of RNA melting |
| vrnainverse | Find RNA sequences with a given secondary structure |
| vrnalalifoldpf | Calculate secondary structures for a set of aligned RNAs (partition) |
| vrnalfold | Calculate locally stable secondary structures of RNAs |
| vrnalfoldz | Calculate locally stable secondary structures of RNAs plus zscore |
| vrnaplfold | Compute avg. pair probabilities for local base pairs in RNA sequences |
| vrnaplot | Draw RNA secondary structures |
| vrnasubopt | Calculate suboptimal secondary structures of RNAs |
Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author.