![]() |
vrnafold |
Please help by correcting and extending the Wiki pages.
The original program has additional inputs and produces different outputs, depending on the options selected. In the EMBASSY implementation it is split into vrnafold for a single sequence and vrnafoldpair for a pair of sequences
% vrnafold -constraintfile rna1.fold Calculate secondary structures of RNAs Input nucleotide sequence: rna1.seq Vienna RNAfold output file [rna1.vrnafold]: |
Go to the input files for this example
Go to the output files for this example
Example 2
% vrnafold Calculate secondary structures of RNAs Input nucleotide sequence: rna1.seq Vienna RNAfold output file [rna1.vrnafold]: |
Go to the output files for this example
Calculate secondary structures of RNAs Version: EMBOSS:6.2.0 Standard (Mandatory) qualifiers: [-sequence] sequence Nucleotide sequence filename and optional format, or reference (input USA) [-outfile] outfile [*.vrnafold] Vienna RNAfold output file Additional (Optional) qualifiers: (none) Advanced (Unprompted) qualifiers: -constraintfile infile Vienna RNA structure constraints file (optional) -paramfile infile Vienna RNA parameters file (optional) -temperature float [37.0] Temperature (Any numeric value) -circular boolean [N] Allow circular RNA -[no]gu boolean [Y] Allow GU pairs -[no]closegu boolean [Y] Allow GU pairs at end of helices -[no]lp boolean [Y] Allow lonely pairs -[no]convert boolean [Y] Convert T to U -nsbases string Non-standard bases (Any string) -[no]tetraloop boolean [Y] Stabilizing energies for tetra-loops -energy menu [0] Rarely used option to fold sequences from the ABCD... alphabet (Values: 0 (BP); 1 (Any with GC); 2 (Any with AU parameters)) -scale float [1.07] Estimate of ensemble free energy (Any numeric value) -dangles menu [1] Method (Values: 0 (Ignore); 1 (Only unpaired bases for just one dangling end); 2 (Always use dangling energies); 3 (Allow coaxial stacking of adjacent helices)) -ssoutfile outfile [*.vrnafold] Vienna RNA structure postscript output file Associated qualifiers: "-sequence" associated qualifiers -sbegin1 integer Start of the sequence to be used -send1 integer End of the sequence to be used -sreverse1 boolean Reverse (if DNA) -sask1 boolean Ask for begin/end/reverse -snucleotide1 boolean Sequence is nucleotide -sprotein1 boolean Sequence is protein -slower1 boolean Make lower case -supper1 boolean Make upper case -sformat1 string Input sequence format -sdbname1 string Database name -sid1 string Entryname -ufo1 string UFO features -fformat1 string Features format -fopenfile1 string Features file name "-outfile" associated qualifiers -odirectory2 string Output directory "-ssoutfile" associated qualifiers -odirectory string Output directory General qualifiers: -auto boolean Turn off prompts -stdout boolean Write first file to standard output -filter boolean Read first file from standard input, write first file to standard output -options boolean Prompt for standard and additional values -debug boolean Write debug output to program.dbg -verbose boolean Report some/full command line options -help boolean Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose -warning boolean Report warnings -error boolean Report errors -fatal boolean Report fatal errors -die boolean Report dying program messages -version boolean Report version number and exit |
Qualifier | Type | Description | Allowed values | Default | ||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
Standard (Mandatory) qualifiers | ||||||||||||
[-sequence] (Parameter 1) |
sequence | Nucleotide sequence filename and optional format, or reference (input USA) | Readable sequence | Required | ||||||||
[-outfile] (Parameter 2) |
outfile | Vienna RNAfold output file | Output file | <*>.vrnafold | ||||||||
Additional (Optional) qualifiers | ||||||||||||
(none) | ||||||||||||
Advanced (Unprompted) qualifiers | ||||||||||||
-constraintfile | infile | Vienna RNA structure constraints file (optional) | Input file | Required | ||||||||
-paramfile | infile | Vienna RNA parameters file (optional) | Input file | Required | ||||||||
-temperature | float | Temperature | Any numeric value | 37.0 | ||||||||
-circular | boolean | Allow circular RNA | Boolean value Yes/No | No | ||||||||
-[no]gu | boolean | Allow GU pairs | Boolean value Yes/No | Yes | ||||||||
-[no]closegu | boolean | Allow GU pairs at end of helices | Boolean value Yes/No | Yes | ||||||||
-[no]lp | boolean | Allow lonely pairs | Boolean value Yes/No | Yes | ||||||||
-[no]convert | boolean | Convert T to U | Boolean value Yes/No | Yes | ||||||||
-nsbases | string | Non-standard bases | Any string | |||||||||
-[no]tetraloop | boolean | Stabilizing energies for tetra-loops | Boolean value Yes/No | Yes | ||||||||
-energy | list | Rarely used option to fold sequences from the ABCD... alphabet |
|
0 | ||||||||
-scale | float | Estimate of ensemble free energy | Any numeric value | 1.07 | ||||||||
-dangles | list | Method |
|
1 | ||||||||
-ssoutfile | outfile | Vienna RNA structure postscript output file | Output file | <*>.vrnafold | ||||||||
Associated qualifiers | ||||||||||||
"-sequence" associated sequence qualifiers | ||||||||||||
-sbegin1 -sbegin_sequence |
integer | Start of the sequence to be used | Any integer value | 0 | ||||||||
-send1 -send_sequence |
integer | End of the sequence to be used | Any integer value | 0 | ||||||||
-sreverse1 -sreverse_sequence |
boolean | Reverse (if DNA) | Boolean value Yes/No | N | ||||||||
-sask1 -sask_sequence |
boolean | Ask for begin/end/reverse | Boolean value Yes/No | N | ||||||||
-snucleotide1 -snucleotide_sequence |
boolean | Sequence is nucleotide | Boolean value Yes/No | N | ||||||||
-sprotein1 -sprotein_sequence |
boolean | Sequence is protein | Boolean value Yes/No | N | ||||||||
-slower1 -slower_sequence |
boolean | Make lower case | Boolean value Yes/No | N | ||||||||
-supper1 -supper_sequence |
boolean | Make upper case | Boolean value Yes/No | N | ||||||||
-sformat1 -sformat_sequence |
string | Input sequence format | Any string | |||||||||
-sdbname1 -sdbname_sequence |
string | Database name | Any string | |||||||||
-sid1 -sid_sequence |
string | Entryname | Any string | |||||||||
-ufo1 -ufo_sequence |
string | UFO features | Any string | |||||||||
-fformat1 -fformat_sequence |
string | Features format | Any string | |||||||||
-fopenfile1 -fopenfile_sequence |
string | Features file name | Any string | |||||||||
"-outfile" associated outfile qualifiers | ||||||||||||
-odirectory2 -odirectory_outfile |
string | Output directory | Any string | |||||||||
"-ssoutfile" associated outfile qualifiers | ||||||||||||
-odirectory | string | Output directory | Any string | |||||||||
General qualifiers | ||||||||||||
-auto | boolean | Turn off prompts | Boolean value Yes/No | N | ||||||||
-stdout | boolean | Write first file to standard output | Boolean value Yes/No | N | ||||||||
-filter | boolean | Read first file from standard input, write first file to standard output | Boolean value Yes/No | N | ||||||||
-options | boolean | Prompt for standard and additional values | Boolean value Yes/No | N | ||||||||
-debug | boolean | Write debug output to program.dbg | Boolean value Yes/No | N | ||||||||
-verbose | boolean | Report some/full command line options | Boolean value Yes/No | Y | ||||||||
-help | boolean | Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose | Boolean value Yes/No | N | ||||||||
-warning | boolean | Report warnings | Boolean value Yes/No | Y | ||||||||
-error | boolean | Report errors | Boolean value Yes/No | Y | ||||||||
-fatal | boolean | Report fatal errors | Boolean value Yes/No | Y | ||||||||
-die | boolean | Report dying program messages | Boolean value Yes/No | Y | ||||||||
-version | boolean | Report version number and exit | Boolean value Yes/No | N |
.((.......<<..........||............)).. |
>rna1 CACUACUCCAAGGACCGUAUCUUUCUCAGUGCGACAGUAA |
CACUACUCCAAGGACCGUAUCUUUCUCAGUGCGACAGUAA ...((((..(((((.....)))))...))))......... ( -2.20) |
CACUACUCCAAGGACCGUAUCUUUCUCAGUGCGACAGUAA .(((..((....)).(((((........)))))..))).. ( -3.50) |
Program name | Description |
---|---|
einverted | Finds inverted repeats in nucleotide sequences |
vrnaalifold | RNA alignment folding |
vrnaalifoldpf | RNA alignment folding with partition |
vrnacofold | RNA cofolding |
vrnacofoldconc | RNA cofolding with concentrations |
vrnacofoldpf | RNA cofolding with partitioning |
vrnadistance | RNA distances |
vrnaduplex | RNA duplex calculation |
vrnaeval | RNA eval |
vrnaevalpair | RNA eval with cofold |
vrnafoldpf | Secondary structures of RNAs with partition |
vrnaheat | RNA melting |
vrnainverse | RNA sequences matching a structure |
vrnalfold | Calculate locally stable secondary structures of RNAs |
vrnaplot | Plot vrnafold output |
vrnasubopt | Calculate RNA suboptimals |
Although we take every care to ensure that the results of the EMBOSS version are identical to those from the original package, we recommend that you check your inputs give the same results in both versions before publication.
Please report all bugs in the EMBOSS version to the EMBOSS bug team, not to the original author.