![]() |
vrnaplot |
Please help by correcting and extending the Wiki pages.
% vrnaplot Plot vrnafold output Vienna RNAfold output file: ../vrnafold-keep/rna1.vrnafold Vienna RNAfold output file [rna1.vrnaplot]: |
Go to the input files for this example
Go to the output files for this example
Plot vrnafold output Version: EMBOSS:6.3.0 Standard (Mandatory) qualifiers: [-structuresfile] infile Vienna RNAfold output file [-outfile] outfile [*.vrnaplot] Vienna RNAfold output file Additional (Optional) qualifiers: (none) Advanced (Unprompted) qualifiers: -layout menu [naview] Layout (Values: radial (Simple radial); naview (naview)) -optype menu [ps] Type (Values: ps (postscript); gml (graph meta language); svg (scaleable vector graphics); xrna (XRNA save file)) -pre string Pre-annotation (Any string) -post string Post-annotation (Any string) Associated qualifiers: "-outfile" associated qualifiers -odirectory2 string Output directory General qualifiers: -auto boolean Turn off prompts -stdout boolean Write first file to standard output -filter boolean Read first file from standard input, write first file to standard output -options boolean Prompt for standard and additional values -debug boolean Write debug output to program.dbg -verbose boolean Report some/full command line options -help boolean Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose -warning boolean Report warnings -error boolean Report errors -fatal boolean Report fatal errors -die boolean Report dying program messages -version boolean Report version number and exit |
Qualifier | Type | Description | Allowed values | Default | ||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
Standard (Mandatory) qualifiers | ||||||||||||
[-structuresfile] (Parameter 1) |
infile | Vienna RNAfold output file | Input file | Required | ||||||||
[-outfile] (Parameter 2) |
outfile | Vienna RNAfold output file | Output file | <*>.vrnaplot | ||||||||
Additional (Optional) qualifiers | ||||||||||||
(none) | ||||||||||||
Advanced (Unprompted) qualifiers | ||||||||||||
-layout | list | Layout |
|
naview | ||||||||
-optype | list | Type |
|
ps | ||||||||
-pre | string | Pre-annotation | Any string | |||||||||
-post | string | Post-annotation | Any string | |||||||||
Associated qualifiers | ||||||||||||
"-outfile" associated outfile qualifiers | ||||||||||||
-odirectory2 -odirectory_outfile |
string | Output directory | Any string | |||||||||
General qualifiers | ||||||||||||
-auto | boolean | Turn off prompts | Boolean value Yes/No | N | ||||||||
-stdout | boolean | Write first file to standard output | Boolean value Yes/No | N | ||||||||
-filter | boolean | Read first file from standard input, write first file to standard output | Boolean value Yes/No | N | ||||||||
-options | boolean | Prompt for standard and additional values | Boolean value Yes/No | N | ||||||||
-debug | boolean | Write debug output to program.dbg | Boolean value Yes/No | N | ||||||||
-verbose | boolean | Report some/full command line options | Boolean value Yes/No | Y | ||||||||
-help | boolean | Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose | Boolean value Yes/No | N | ||||||||
-warning | boolean | Report warnings | Boolean value Yes/No | Y | ||||||||
-error | boolean | Report errors | Boolean value Yes/No | Y | ||||||||
-fatal | boolean | Report fatal errors | Boolean value Yes/No | Y | ||||||||
-die | boolean | Report dying program messages | Boolean value Yes/No | Y | ||||||||
-version | boolean | Report version number and exit | Boolean value Yes/No | N |
CACUACUCCAAGGACCGUAUCUUUCUCAGUGCGACAGUAA .(((..((....)).(((((........)))))..))).. ( -3.50) |
Program name | Description |
---|---|
einverted | Finds inverted repeats in nucleotide sequences |
vrnaalifold | RNA alignment folding |
vrnaalifoldpf | RNA alignment folding with partition |
vrnacofold | RNA cofolding |
vrnacofoldconc | RNA cofolding with concentrations |
vrnacofoldpf | RNA cofolding with partitioning |
vrnadistance | RNA distances |
vrnaduplex | RNA duplex calculation |
vrnaeval | RNA eval |
vrnaevalpair | RNA eval with cofold |
vrnafold | Calculate secondary structures of RNAs |
vrnafoldpf | Secondary structures of RNAs with partition |
vrnaheat | RNA melting |
vrnainverse | RNA sequences matching a structure |
vrnalfold | Calculate locally stable secondary structures of RNAs |
vrnasubopt | Calculate RNA suboptimals |
Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author.