vrnaplot

 

Wiki

The master copies of EMBOSS documentation are available at http://emboss.open-bio.org/wiki/Appdocs on the EMBOSS Wiki.

Please help by correcting and extending the Wiki pages.

Function

Plot vrnafold output

Description

This is a port of the Vienna RNA package program RNAplot.

Algorithm

See the original documentation for the Vienna RNA package http://www.tbi.univie.ac.at/~ivo/RNA/

Usage

Here is a sample session with vrnaplot 


% vrnaplot 
Plot vrnafold output
Vienna RNAfold output file: ../vrnafold-keep/rna1.vrnafold
Vienna RNAfold output file [rna1.vrnaplot]:

Go to the input files for this example
Go to the output files for this example

Command line arguments 

Plot vrnafold output
Version: EMBOSS:6.3.0

   Standard (Mandatory) qualifiers:
  [-structuresfile]    infile     Vienna RNAfold output file
  [-outfile]           outfile    [*.vrnaplot] Vienna RNAfold output file

   Additional (Optional) qualifiers: (none)
   Advanced (Unprompted) qualifiers:
   -layout             menu       [naview] Layout (Values: radial (Simple
                                  radial); naview (naview))
   -optype             menu       [ps] Type (Values: ps (postscript); gml
                                  (graph meta language); svg (scaleable vector
                                  graphics); xrna (XRNA save file))
   -pre                string     Pre-annotation (Any string)
   -post               string     Post-annotation (Any string)

   Associated qualifiers:

   "-outfile" associated qualifiers
   -odirectory2        string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write first file to standard output
   -filter             boolean    Read first file from standard input, write
                                  first file to standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options and exit. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages
   -version            boolean    Report version number and exit

Qualifier Type Description Allowed values Default
Standard (Mandatory) qualifiers
[-structuresfile]
(Parameter 1)		 infile Vienna RNAfold output file Input file Required
[-outfile]
(Parameter 2)		 outfile Vienna RNAfold output file Output file <*>.vrnaplot
Additional (Optional) qualifiers
(none)
Advanced (Unprompted) qualifiers
-layout list Layout
radial (Simple radial)
naview (naview)
 naview
-optype list Type
ps (postscript)
gml (graph meta language)
svg (scaleable vector graphics)
xrna (XRNA save file)
 ps
-pre string Pre-annotation Any string  
-post string Post-annotation Any string  
Associated qualifiers
"-outfile" associated outfile qualifiers
-odirectory2
-odirectory_outfile		 string Output directory Any string  
General qualifiers
-auto boolean Turn off prompts Boolean value Yes/No N
-stdout boolean Write first file to standard output Boolean value Yes/No N
-filter boolean Read first file from standard input, write first file to standard output Boolean value Yes/No N
-options boolean Prompt for standard and additional values Boolean value Yes/No N
-debug boolean Write debug output to program.dbg Boolean value Yes/No N
-verbose boolean Report some/full command line options Boolean value Yes/No Y
-help boolean Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose Boolean value Yes/No N
-warning boolean Report warnings Boolean value Yes/No Y
-error boolean Report errors Boolean value Yes/No Y
-fatal boolean Report fatal errors Boolean value Yes/No Y
-die boolean Report dying program messages Boolean value Yes/No Y
-version boolean Report version number and exit Boolean value Yes/No N

Input file format

vrnaplot reads any normal sequence USAs.

Input files for usage example

File: ../vrnafold-keep/rna1.vrnafold

CACUACUCCAAGGACCGUAUCUUUCUCAGUGCGACAGUAA
.(((..((....)).(((((........)))))..))).. ( -3.50)

Output file format

vrnaplot outputs a graph to the specified graphics device. outputs a report format file. The default format is ...

Output files for usage example

Graphics File: rna1.vrnaplot

[vrnaplot results]

Data files

For details of Vienna RNA file formats, see the original documentation http://www.tbi.univie.ac.at/~ivo/RNA/

Notes

None.

References

None.

Warnings

None.

Diagnostic Error Messages

None.

Exit status

It always exits with status 0.

Known bugs

None.

See also

Program name Description
einverted Finds inverted repeats in nucleotide sequences
vrnaalifold RNA alignment folding
vrnaalifoldpf RNA alignment folding with partition
vrnacofold RNA cofolding
vrnacofoldconc RNA cofolding with concentrations
vrnacofoldpf RNA cofolding with partitioning
vrnadistance RNA distances
vrnaduplex RNA duplex calculation
vrnaeval RNA eval
vrnaevalpair RNA eval with cofold
vrnafold Calculate secondary structures of RNAs
vrnafoldpf Secondary structures of RNAs with partition
vrnaheat RNA melting
vrnainverse RNA sequences matching a structure
vrnalfold Calculate locally stable secondary structures of RNAs
vrnasubopt Calculate RNA suboptimals

Author(s)

Peter Rice
European Bioinformatics Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge CB10 1SD, UK

Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author.

History

Converted (October 2005) by Alan Bleasby

Target users

This program is intended to be used by everyone and everything, from naive users to embedded scripts.

Comments