emast

 

Wiki

The master copies of EMBOSS documentation are available at http://emboss.open-bio.org/wiki/Appdocs on the EMBOSS Wiki.

Please help by correcting and extending the Wiki pages.

Function

Motif detection

Description

EMBASSY MEME is a suite of application wrappers to the original meme v3.0.14 applications written by Timothy Bailey. meme v3.0.14 must be installed on the same system as EMBOSS and the location of the meme executables must be defined in your path for EMBASSY MEME to work.

Usage:
ememe [options] mfile outfile

The outfile parameter is new to EMBASSY MEME. The output is always written to .

MAST: Motif Alignment and Search Tool

MAST is a tool for searching biological sequence databases for sequences that contain one or more of a group of known motifs.

A motif is a sequence pattern that occurs repeatedly in a group of related protein or DNA sequences. Motifs are represented as position-dependent scoring matrices that describe the score of each possible letter at each position in the pattern. Individual motifs may not contain gaps. Patterns with variable-length gaps must be split into two or more separate motifs before being submitted as input to MAST.

MAST takes as input a file containing the descriptions of one or more motifs and searches a sequence database that you select for sequences that match the motifs. The motif file can be the output of the MEME motif discovery tool or any file in the appropriate format.

MAST outputs three things:

MAST works by calculating match scores for each sequence in the database compared with each of the motifs in the group of motifs you provide. For each sequence, the match scores are converted into various types of p-values and these are used to determine the overall match of the sequence to the group of motifs and the probable order and spacing of occurrences of the motifs in the sequence.

Algorithm

Please read the file README distributed with the original MEME.

Usage

Here is a sample session with emast


% emast ex1.html crp0.s 
Motif detection
Print results for sequences with E-value [10]: 
Show motif matches with p-value < mt [0.0001]: 
MAST program output directory [mast_out]: 
Writing results to output directory 'mast_out/'.


Go to the input files for this example
Go to the output files for this example

EXAMPLES:

Please note the examples below are unedited excerpts of the original MEME documentation. Bear in mind the EMBASSY and original MEME options may differ in practice (see "1. Command-line arguments").

The following examples assume that file "meme.results" is the output of a MEME run containing at least 3 motifs and file SwissProt is a copy of the Swiss-Prot database on your local disk. DNA_DB is a copy of a DNA database on your local disk.

1) Annotate the training set:
mast meme.results

2) Find sequences matching the motif and annotate them in the SwissProt database:
mast meme.results -d SwissProt

3) Show sequences with weaker combined matches to motifs.
mast meme.results -d SwissProt -ev 200

4) Indicate weaker matches to single motifs in the annotation so that sequences with weak matches to the motifs (but perhaps with the "correct" order and spacing) can be seen:
mast meme.results -d SwissProt -w

5) Include a nominal order and spacing of the first three motifs in the calculation of the sequence p-values to increase the sensitivity of the search for matching sequences:
mast meme.results -d SwissProt -diag "9-[2]-61-[1]-62-[3]-91"

6) Use only the first and third motifs in the search:
mast meme.results -d SwissProt -m 1 -m 3

7) Use only the first two motifs in the search:
mast meme.results -d SwissProt -c 2

8) Search DNA sequences using protein motifs, adjusting p-values and E-values for each sequence by that sequence's composition:
mast meme.results -d DNA_DB -dna -comp

Command line arguments

Where possible, the same command-line qualifier names and parameter order is used as in the original mast. There are however several unavoidable differences and these are clearly documented in the "Notes" section below.

Most of the options in the original mast are given in ACD as "advanced" or "additional" options. -options must be specified on the command-line in order to be prompted for a value for "additional" options but "advanced" options will never be prompted for.

Please note that one only of -stdin or -d should be specified. If you set both, then -d will be used. This behaviour could have been enforced at the level of the ACD file by using an ACD select: or list: type but this would have been inconsistent with the original meme, which has two separate options.

Motif detection
Version: EMBOSS:6.5.0.0

   Standard (Mandatory) qualifiers:
  [-mfile]             infile     If -d  is not given, MAST looks
                                  for database specified inside of .
  [-sfile]             infile     If -d  is not given, MAST looks
                                  for database specified inside of .
   -ev                 float      [10] Print results for sequences with
                                  E-value (Any numeric value)
   -mt                 float      [0.0001] Show motif matches with p-value <
                                  mt (Any numeric value)
  [-outdirname]        outdir     [mast_out] MAST program output directory

   Additional (Optional) qualifiers:
   -dblist             boolean    [N] If provided, -sfile is a list of files
   -bfile              infile     The random model uses the letter frequencies
                                  given in  instead of the
                                  non-redundant database frequencies. The
                                  format of  is the same as that for
                                  the MEME -bfile opton; see the MEME
                                  documentation for details. Sample files are
                                  given in directory tests: tests/nt.freq and
                                  tests/na.freq in the MEME distribution.)
   -stdin              boolean    [N] The default is to read the database
                                  specified inside .
   -[no]text           boolean    [Y] Default is text, HTML and XML
   -[no]html           boolean    [Y] Default is text, HTML and XML
   -dna                boolean    [N] Translate DNA sequences to protein
   -comp               boolean    [N] The random model uses the letter
                                  frequencies in the current target sequence
                                  instead of the non-redundant database
                                  frequencies. This causes p-values and
                                  E-values to be compensated individually for
                                  the actual composition of each sequence in
                                  the database. This option can increase
                                  search time substantially due to the need to
                                  compute a different score distribution for
                                  each high-scoring sequence.
   -best               boolean    [N] Include only the best motif in diagrams
   -remcorr            boolean    [N] Remove highly correlated motifs from
                                  query
   -nostatus           boolean    [N] Do not print progress report
   -hitlist            boolean    [N] If you specify the -hitlist switch to
                                  MAST, the motif 'diagram' takes the form of
                                  a comma separated list of motif occurrences
                                  ('hits'). Each 'hit' has the format:
                                     
                                  where  is the strand (+ or - for
                                  DNA, blank for protein),  is the
                                  motif number,  is the starting
                                  position of the hit,  is the ending
                                  position of the hit, and  is the
                                  position p-value of the hit.

   Advanced (Unprompted) qualifiers:
   -c                  integer    [-1] Only use the first  motifs (Any
                                  integer value)
   -sep                boolean    [N] Score reverse complement DNA strand as a
                                  separate sequence
   -norc               boolean    [N] Do not score reverse complement DNA
                                  strand
   -weak               boolean    [N] Show weak matches (mt as motif file name. (Any string)
   -df                 string     Print  as database name. (Any string)
   -dl                 string     Print 
as link to search sequence names. (Any string) -minseqs integer [-1] Lower bound on number of sequences in db (Any integer value) -mev float [-1] Use only motifs with E-values less than (Any numeric value) -m integer [-1] Overrides value set by using -mev. (Any integer value) -diag string See on-line documentation for a valid example. (Any string) -[no]overwrite boolean [Y] The default is to overwrite existing files Associated qualifiers: "-outdirname" associated qualifiers -extension3 string Default file extension General qualifiers: -auto boolean Turn off prompts -stdout boolean Write first file to standard output -filter boolean Read first file from standard input, write first file to standard output -options boolean Prompt for standard and additional values -debug boolean Write debug output to program.dbg -verbose boolean Report some/full command line options -help boolean Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose -warning boolean Report warnings -error boolean Report errors -fatal boolean Report fatal errors -die boolean Report dying program messages -version boolean Report version number and exit

Qualifier Type Description Allowed values Default
Standard (Mandatory) qualifiers
[-mfile]
(Parameter 1)
infile If -d <database> is not given, MAST looks for database specified inside of <mfile>. Input file Required
[-sfile]
(Parameter 2)
infile If -d <database> is not given, MAST looks for database specified inside of <mfile>. Input file Required
-ev float Print results for sequences with E-value Any numeric value 10
-mt float Show motif matches with p-value < mt Any numeric value 0.0001
[-outdirname]
(Parameter 3)
outdir MAST program output directory Output directory mast_out
Additional (Optional) qualifiers
-dblist boolean If provided, -sfile is a list of files Boolean value Yes/No No
-bfile infile The random model uses the letter frequencies given in <bfile> instead of the non-redundant database frequencies. The format of <bfile> is the same as that for the MEME -bfile opton; see the MEME documentation for details. Sample files are given in directory tests: tests/nt.freq and tests/na.freq in the MEME distribution.) Input file Required
-stdin boolean The default is to read the database specified inside <mfile>. Boolean value Yes/No No
-[no]text boolean Default is text, HTML and XML Boolean value Yes/No Yes
-[no]html boolean Default is text, HTML and XML Boolean value Yes/No Yes
-dna boolean Translate DNA sequences to protein Boolean value Yes/No No
-comp boolean The random model uses the letter frequencies in the current target sequence instead of the non-redundant database frequencies. This causes p-values and E-values to be compensated individually for the actual composition of each sequence in the database. This option can increase search time substantially due to the need to compute a different score distribution for each high-scoring sequence. Boolean value Yes/No No
-best boolean Include only the best motif in diagrams Boolean value Yes/No No
-remcorr boolean Remove highly correlated motifs from query Boolean value Yes/No No
-nostatus boolean Do not print progress report Boolean value Yes/No No
-hitlist boolean If you specify the -hitlist switch to MAST, the motif 'diagram' takes the form of a comma separated list of motif occurrences ('hits'). Each 'hit' has the format: <strand><motif> <start> <end> <p-value> where <strand> is the strand (+ or - for DNA, blank for protein), <motif> is the motif number, <start> is the starting position of the hit, <end> is the ending position of the hit, and <p-value> is the position p-value of the hit. Boolean value Yes/No No
Advanced (Unprompted) qualifiers
-c integer Only use the first <c> motifs Any integer value -1
-sep boolean Score reverse complement DNA strand as a separate sequence Boolean value Yes/No No
-norc boolean Do not score reverse complement DNA strand Boolean value Yes/No No
-weak boolean Show weak matches (mt<p-value<mt*10) in angle brackets Boolean value Yes/No No
-seqp boolean The default is to use POSITION p-values. Boolean value Yes/No No
-mf string Print <mf> as motif file name. Any string  
-df string Print <df> as database name. Any string  
-dl string Print <dl> as link to search sequence names. Any string  
-minseqs integer Lower bound on number of sequences in db Any integer value -1
-mev float Use only motifs with E-values less than <mev> Any numeric value -1
-m integer Overrides value set by using -mev. Any integer value -1
-diag string See on-line documentation for a valid example. Any string  
-[no]overwrite boolean The default is to overwrite existing files Boolean value Yes/No Yes
Associated qualifiers
"-outdirname" associated outdir qualifiers
-extension3
-extension_outdirname
string Default file extension Any string  
General qualifiers
-auto boolean Turn off prompts Boolean value Yes/No N
-stdout boolean Write first file to standard output Boolean value Yes/No N
-filter boolean Read first file from standard input, write first file to standard output Boolean value Yes/No N
-options boolean Prompt for standard and additional values Boolean value Yes/No N
-debug boolean Write debug output to program.dbg Boolean value Yes/No N
-verbose boolean Report some/full command line options Boolean value Yes/No Y
-help boolean Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose Boolean value Yes/No N
-warning boolean Report warnings Boolean value Yes/No Y
-error boolean Report errors Boolean value Yes/No Y
-fatal boolean Report fatal errors Boolean value Yes/No Y
-die boolean Report dying program messages Boolean value Yes/No Y
-version boolean Report version number and exit Boolean value Yes/No N

Input file format





Input files for usage example

File: ex1.html

<!DOCTYPE html PUBLIC "-//W3C//DTD HTML 4.01 Transitional//EN" "http://www.w3.org/TR/html4/loose.dtd"> <html> <head> <meta http-equiv="Content-Type" content="text/html; charset=UTF-8"> <title>MEME</title> <style type="text/css"> /* START INCLUDED FILE "meme.css" */ /* The following is the content of meme.css */ body { background-color:white; font-size: 12px; font-family: Verdana, Arial, Helvetica, sans-serif;} div.help { display: inline-block; margin: 0px; padding: 0px; width: 12px; height: 13px; cursor: pointer; background-image: url("help.gif"); background-image: url("data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAAwAAAANAQMAAACn5x0BAAAAAXNSR0IArs4c6QAAAAZQTFRFAAAAnp6eqp814gAAAAF0Uk5TAEDm2GYAAAABYktHRACIBR1IAAAACXBIWXMAAAsTAAALEwEAmpwYAAAAB3RJTUUH2gMJBQgGYqhNZQAAACZJREFUCNdj+P+BoUGAoV+AYeYEEGoWYGgTYGgRAAm2gRGQ8f8DAOnhC2lYnqs6AAAAAElFTkSuQmCC"); } div.help2 { color: #999; display: inline-block; width: 12px; height: 12px; border: 1px solid #999; font-size: 13px; line-height:12px; font-family: Helvetica, sans-serif; font-weight: bold; font-style: normal; cursor: pointer; } div.help2:hover { color: #000; border-color: #000; } p.spaced { line-height: 1.8em;} span.citation { font-family: "Book Antiqua", "Palatino Linotype", serif; color: #004a4d;} p.pad { padding-left: 30px; padding-top: 5px; padding-bottom: 10px;} td.jump { font-size: 13px; color: #ffffff; background-color: #00666a; font-family: Georgia, "Times New Roman", Times, serif;} a.jump { margin: 15px 0 0; font-style: normal; font-variant: small-caps; [Part of this file has been deleted for brevity] For use with <a href="http://blocks.fhcrc.org/blocks">BLOCKS tools</a>. </dd> <dt> <a name="format_FASTA_doc"></a>FASTA Format</dt> <dd> The FASTA format as described <a href="http://meme.nbcr.net/meme/doc/fasta-format.html">here</a>. </dd> <dt> <a name="format_raw_doc"></a>Raw Format</dt> <dd> Just the sites of the sequences that contributed to the motif. One site per line. </dd> </dl> </div> <a name="sites_doc"></a><h5 class="doc">Sites</h5> <div class="doc"><p> MEME displays the occurrences (sites) of the motif in the training set. The sites are shown aligned with each other, and the ten sequence positions preceding and following each site are also shown. Each site is identified by the name of the sequence where it occurs, the strand (if both strands of DNA sequences are being used), and the position in the sequence where the site begins. When the DNA strand is specified, '+' means the sequence in the training set, and '-' means the reverse complement of the training set sequence. (For '-' strands, the 'start' position is actually the position on the <b>positive</b> strand where the site ends.) The sites are <b>listed in order of increasing statistical significance</b> (<i>p</i>-value). The <i>p</i>-value of a site is computed from the the match score of the site with the <a href="#format_PSSM_doc">position specific scoring matrix</a> for the motif. The <i>p</i>-value gives the probability of a random string (generated from the background letter frequencies) having the same match score or higher. (This is referred to as the <b>position <i>p</i>-value</b> by the MAST algorithm.) </p></div> <a name="diagrams_doc"></a><h5 class="doc">Block Diagrams</h5> <div class="doc"><p> The occurrences of the motif in the training set sequences are shown as coloured blocks on a line. One diagram is printed for each sequence showing all the sites contributating to that motif in that sequence. The sequences are <b>listed in the same order as in the input</b> to make it easier to compare multiple block diagrams. Additionally the best <i>p</i>-value for the sequence/motif combination is listed though this may not be in ascending order as with the sites. The <i>p</i>-value of an occurrence is the probability of a single random subsequence the length of the motif, generated according to the 0-order background model, having a score at least as high as the score of the occurrence. When the DNA strand is specified '+', it means the motif appears from left to right on the sequence, and '-' means the motif appears from right to left on the complementary strand. A sequence position scale is shown at the end of each table of block diagrams. </p></div> <a name="combined_doc"></a><h5>Combined Block Diagrams</h5> <div class="doc"> <p> The motif occurrences shown in the motif summary <b>may not be exactly the same as those reported in each motif section</b> because only motifs with a position <em>p</em>-value of 0.0001 that don't overlap other, more significant motif occurrences are shown. </p> <p> See the documentation for <a href="http://meme.nbcr.net/meme/mast-output.html">MAST output</a> for the definition of position and combined <em>p</em>-values. </p> </div> </div></span><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br> </form></body> </html>

MOTIF FORMAT

MAST can search using (multiple) motifs contained in

Motif file format

  
       ALPHABET= alphabet
       log-odds matrix: alength= alength w= w
       row_1
       row_2
       ...
       row_w  

A motif is represented by a position-dependent scoring matrix.

A scoring matrix is preceded by a line starting with the words log-odds matrix: and specifying alength, the length of the alphabet (number of columns in the scoring matrix), and the w, the width of the motif (number of rows in the scoring matrix).

The following w lines (no blank lines allowed) contain the rows of the scoring matrix. Row i, column j of the matrix gives the score for the j-th letter in alphabet appearing at position i in an occurrence of the motif.

The spaces after the equals signs and the colon are required.

The number of letters in alphabet must equal alength.

Any number of additional motifs may follow the first one.

The motif file must contain a line starting with

              ALPHABET= 
followed by alphabet, a list containing the letters used in the motifs.

The order of the letters in alphabet must be the same as the order of the columns of scores in the motifs. The order need not be alphabetical and case does not matter, but there should be no spaces in alphabet.

The letters in alphabet must be a subset of either the IUB/IUPAC DNA (ABCDGHKMNRSTUVWY) or protein (ABCDEFGHIKLMNPQRSTUVWXYZ) alphabets. DNA alphabets must contain at least the letters ACGT. Protein alphabets must contain at least the letters ACDEFGHIKLMNPQRSTVWY. All other letters in the alphabets are optional. If any of the optional letters are missing from alphabet, MAST automatically generates scores for them by taking the weighted average of the scores for the letters which the missing letter could match. (The weights are the frequencies of the replaced letters in the appropriate non-redundant database.) Replacements for the optional letters are given in the following table.

LETTERS MATCHED BY OPTIONAL LETTERS

      =================================================
      optional          matches 
      letter      DNA             protein 
      =================================================
       B          CGT             DN 
       D          AGT
       H          ACT
       K          GT
       M          AC
       N          ACGT
       R          AG
       S          CG
       U          T               ACDEFGHIKLMNPQRSTVWY 
       V          CAG
       W          AT
       X                          ACDEFGHIKLMNPQRSTVWY 
       Y          CT
       Z                          EQ 
       *          ACGT            ACDEFGHIKLMNPQRSTVWY
       -          ACGT            ACDEFGHIKLMNPQRSTVWY
      =================================================

EXAMPLE

Here is an example of a DNA motif file that contains two motifs.

Sample motif file

  
          ALPHABET= ACGT
          log-odds matrix: alength= 4 w= 9
           -4.275  -0.182  -4.195   1.408
           -4.296  -1.487   1.880  -0.816
           -2.160  -1.492  -4.171   1.474
           -0.810  -4.076   1.872  -2.164
            1.537  -1.487  -4.195  -4.205
            0.113   0.340  -0.237  -0.209
           -0.454   0.923   0.390  -0.834
           -1.336  -0.082   0.905   0.100
            0.674  -4.183   0.130  -0.201
          log-odds matrix: alength= 4 w= 6
           -2.032   0.324   1.371  -0.781
           -0.409   0.560  -0.250   0.119
           -4.274  -0.519  -0.260   1.167
           -2.188   2.300  -4.191  -2.465
            1.265  -4.111  -0.267  -2.180
           -1.977   2.158  -1.661  -2.071 
In the example above, because the order of the letters in alphabet is ACGT, the first column of each motif gives the scores for the letter A at each position in the motif, the second column gives the scores for C and so forth.

Note: If -d is not given, MAST looks for database specified inside of < mfile >

Creates file (unless [-stdout] given) after stripping ".html" from the end of < mfile >:

mast.< mfile >[.< database >][.c< count >][.m< motif >]+[.rank< rank >][.ev< ev >][.mt< mt >][.b]

Output file format

Output files for usage example

File: crp0.s

>ce1cg
TAATGTTTGTGCTGGTTTTTGTGGCATCGGGCGAGAATAGCGCGTGGTGTGAAAGACTGTTTTTTTGATCGTTTTCACAA
AAATGGAAGTCCACAGTCTTGACAG
>ara
GACAAAAACGCGTAACAAAAGTGTCTATAATCACGGCAGAAAAGTCCACATTGATTATTTGCACGGCGTCACACTTTGCT
ATGCCATAGCATTTTTATCCATAAG
>bglr1
ACAAATCCCAATAACTTAATTATTGGGATTTGTTATATATAACTTTATAAATTCCTAAAATTACACAAAGTTAATAACTG
TGAGCATGGTCATATTTTTATCAAT
>crp
CACAAAGCGAAAGCTATGCTAAAACAGTCAGGATGCTACAGTAATACATTGATGTACTGCATGTATGCAAAGGACGTCAC
ATTACCGTGCAGTACAGTTGATAGC
>cya
ACGGTGCTACACTTGTATGTAGCGCATCTTTCTTTACGGTCAATCAGCAAGGTGTTAAATTGATCACGTTTTAGACCATT
TTTTCGTCGTGAAACTAAAAAAACC
>deop2
AGTGAATTATTTGAACCAGATCGCATTACAGTGATGCAAACTTGTAAGTAGATTTCCTTAATTGTGATGTGTATCGAAGT
GTGTTGCGGAGTAGATGTTAGAATA
>gale
GCGCATAAAAAACGGCTAAATTCTTGTGTAAACGATTCCACTAATTTATTCCATGTCACACTTTTCGCATCTTTGTTATG
CTATGGTTATTTCATACCATAAGCC
>ilv
GCTCCGGCGGGGTTTTTTGTTATCTGCAATTCAGTACAAAACGTGATCAACCCCTCAATTTTCCCTTTGCTGAAAAATTT
TCCATTGTCTCCCCTGTAAAGCTGT
>lac
AACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGG
AATTGTGAGCGGATAACAATTTCAC
>male
ACATTACCGCCAATTCTGTAACAGAGATCACACAAAGCGACGGTGGGGCGTAGGGGCAAGGAGGATGGAAAGAGGTTGCC
GTATAAAGAAACTAGAGTCCGTTTA
>malk
GGAGGAGGCGGGAGGATGAGAACACGGCTTCTGTGAACTAAACCGAGGTCATGTAAGGAATTTCGTGATGTTGCTTGCAA
AAATCGTGGCGATTTTATGTGCGCA
>malt
GATCAGCGTCGTTTTAGGTGAGTTGTTAATAAAGATTTGGAATTGTGACACAGTGCAAATTCAGACACATAAAAAAACGT
CATCGCTTGCATTAGAAAGGTTTCT
>ompa
GCTGACAAAAAAGATTAAACATACCTTATACAAGACTTTTTTTTCATATGCCTGACGGAGTTCACACTTGTAAGTTTTCA
ACTACGTTGTAGACTTTACATCGCC
>tnaa
TTTTTTAAACATTAAAATTCTTACGTAATTTATAATCTTTAAAAAAAGCATTTAATATTGCTCCCCGAACGATTGTGATT
CGATTCACATTTAAACAATTTCAGA
>uxu1
CCCATGAGAGTGAAATTGTTGTGATGTGGTTAACCCAATTAGAATTCGGGATTGACATGTCTTACCAAAAGGTAGAACTT
ATACGCCATCTCATCCGATGCAAGC
>pbr322
CTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAA
GGAGAAAATACCGCATCAGGCGCTC
>trn9cat
CTGTGACGGAAGATCACTTCGCAGAATAAATAAATCCTGGTGTCCCTGTTGATACCGGGAAGCCCTGGGCCAACTTTTGG
CGAAAATGAGACGTTGATCGGCACG
>tdc
GATTTTTATACTTTAACTTGTTGATATTTAAAGGTATTTAATTGTAATAACGATACTCTGGAAAGTATTGAAAGTTAATT
TGTGAGTGGTCGCACATATCCTGTT

Directory: mast_out

This directory contains output files, for example mast.txt mast.html and mast.xml.

File: mast_out/mast.txt

********************************************************************************
MAST - Motif Alignment and Search Tool
********************************************************************************
	MAST version 4.7.0 (Release date: Wed Sep 28 17:30:10 EST 2011)

	For further information on how to interpret these results or to get
	a copy of the MAST software please access http://meme.nbcr.net.
********************************************************************************


********************************************************************************
REFERENCE
********************************************************************************
	If you use this program in your research, please cite:

	Timothy L. Bailey and Michael Gribskov,
	"Combining evidence using p-values: application to sequence homology
	searches", Bioinformatics, 14(48-54), 1998.
********************************************************************************


********************************************************************************
DATABASE AND MOTIFS
********************************************************************************
	DATABASE ./crp0.s (nucleotide)
	Last updated on Tue Jul 17 08:50:26 2012
	Database contains 18 sequences, 1890 residues

	Scores for positive and reverse complement strands are combined.

	MOTIFS ../../data/memenew/ex1.html (nucleotide)
	MOTIF WIDTH BEST POSSIBLE MATCH
	----- ----- -------------------
	  1    15   TGTGAACGAGCTCAC

	Random model letter frequencies (from non-redundant database):
	A 0.274 C 0.225 G 0.225 T 0.274 
********************************************************************************


********************************************************************************
SECTION I: HIGH-SCORING SEQUENCES
********************************************************************************
	- Each of the following 18 sequences has E-value less than 10.
	- The E-value of a sequence is the expected number of sequences
	  in a random database of the same size that would match the motifs as
	  well as the sequence does and is equal to the combined p-value of the
	  sequence times the number of sequences in the database.
	- The combined p-value of a sequence measures the strength of the
	  match of the sequence to all the motifs and is calculated by


  [Part of this file has been deleted for brevity]

  
  LENGTH = 105  COMBINED P-VALUE = 1.09e-02  E-VALUE =      0.2
  DIAGRAM: 65_[+1]_25

                                                                      [+1]
                                                                      6.0e-05
                                                                      TGTGAACGAG
                                                                      ++  ++++++
1    CACAAAGCGAAAGCTATGCTAAAACAGTCAGGATGCTACAGTAATACATTGATGTACTGCATGTATGCAAAGGAC

     
     
     CTCAC
      ++++
76   GTCACATTACCGTGCAGTACAGTTGATAGC


bglr1
  
  LENGTH = 105  COMBINED P-VALUE = 1.92e-02  E-VALUE =     0.35
  DIAGRAM: 105



malk
  
  LENGTH = 105  COMBINED P-VALUE = 3.23e-02  E-VALUE =     0.58
  DIAGRAM: 105



ilv
  
  LENGTH = 105  COMBINED P-VALUE = 5.93e-02  E-VALUE =      1.1
  DIAGRAM: 105



trn9cat
  
  LENGTH = 105  COMBINED P-VALUE = 1.14e-01  E-VALUE =        2
  DIAGRAM: 105


********************************************************************************


CPU: peterlenovo
Time 0.016000 secs.

mast ../../data/memenew/ex1.html ./crp0.s -oc mast_out/ -ev 10.000000 -mt 0.000100

File: mast_out/mast.html

<!DOCTYPE html PUBLIC "-//W3C//DTD HTML 4.01 Transitional//EN" "http://www.w3.org/TR/html4/loose.dtd"> <html> <head> <meta http-equiv="Content-Type" content="text/html; charset=UTF-8"> <meta charset="UTF-8"> <meta name="description" content="Motif Alignment and Search Tool (MAST) output."> <title>MAST</title> <script type="text/javascript"> var motifs = new Array(); motifs["motif_1"] = new Motif("1", "nucleotide", "TGTGAACGAGCTCAC", "GTGAGCTCGTTCACA"); motifs.length = 1; var wrap = undefined;//size to display on one line var wrap_timer; var seqmax = 105; var loadedSequences = new Array(); //draging details var moving_seq; var moving_annobox; var moving_left; var moving_width; var moving_both; //drag needles var dnl = null; var dnr = null; var drag_is_rc = undefined; //container var cont = null; function mouseCoords(ev) { ev = ev || window.event; if(ev.pageX || ev.pageY){ return {x:ev.pageX, y:ev.pageY}; } return { x:ev.clientX + document.body.scrollLeft - document.body.clientLeft, y:ev.clientY + document.body.scrollTop - document.body.clientTop }; } function setup() { rewrap(); window.onresize = delayed_rewrap; } function calculate_wrap() { [Part of this file has been deleted for brevity] 1 GACAAAAACGCGTAACAAAAGTGTCTATAATCACGGCAGAAAAGTCCACATTGATTATTTGCACGGCGTCACACT "> <input type="hidden" id="seq_1_2_hits" value=" 58 motif_1 + 5.5e-05 + ++ +++++ ++++ "> <input type="hidden" id="seq_1_4_len" value="105"> <input type="hidden" id="seq_1_4_desc" value=""> <input type="hidden" id="seq_1_4_combined_pvalue" value="1.09e-02"> <input type="hidden" id="seq_1_4_type" value="nucleotide"> <input type="hidden" id="seq_1_4_segs" value=" 1 CACAAAGCGAAAGCTATGCTAAAACAGTCAGGATGCTACAGTAATACATTGATGTACTGCATGTATGCAAAGGACGTCACATTACCGTGCAGTACAGTTGATAGC "> <input type="hidden" id="seq_1_4_hits" value=" 66 motif_1 + 6.0e-05 ++ ++++++ ++++ "> <input type="hidden" id="seq_1_3_len" value="105"> <input type="hidden" id="seq_1_3_desc" value=""> <input type="hidden" id="seq_1_3_combined_pvalue" value="1.92e-02"> <input type="hidden" id="seq_1_3_type" value="nucleotide"> <input type="hidden" id="seq_1_3_segs" value=" "> <input type="hidden" id="seq_1_3_hits" value=" "> <input type="hidden" id="seq_1_11_len" value="105"> <input type="hidden" id="seq_1_11_desc" value=""> <input type="hidden" id="seq_1_11_combined_pvalue" value="3.23e-02"> <input type="hidden" id="seq_1_11_type" value="nucleotide"> <input type="hidden" id="seq_1_11_segs" value=" "> <input type="hidden" id="seq_1_11_hits" value=" "> <input type="hidden" id="seq_1_8_len" value="105"> <input type="hidden" id="seq_1_8_desc" value=""> <input type="hidden" id="seq_1_8_combined_pvalue" value="5.93e-02"> <input type="hidden" id="seq_1_8_type" value="nucleotide"> <input type="hidden" id="seq_1_8_segs" value=" "> <input type="hidden" id="seq_1_8_hits" value=" "> <input type="hidden" id="seq_1_17_len" value="105"> <input type="hidden" id="seq_1_17_desc" value=""> <input type="hidden" id="seq_1_17_combined_pvalue" value="1.14e-01"> <input type="hidden" id="seq_1_17_type" value="nucleotide"> <input type="hidden" id="seq_1_17_segs" value=" "> <input type="hidden" id="seq_1_17_hits" value=" "> </form> <br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><span class="sequence" id="ruler" style="visibility:hidden; white-space:nowrap;">ACGTN</span> </body> </html>

File: mast_out/mast.xml

<?xml version='1.0' encoding='UTF-8' standalone='yes'?>
<!DOCTYPE mast[
<!ELEMENT mast (model, alphabet, motifs, sequences, runtime)>
<!ATTLIST mast version CDATA #REQUIRED release CDATA #REQUIRED>
<!ELEMENT model (command_line, max_correlation, remove_correlated, strand_handling, translate_dna, max_seq_evalue,
    adj_hit_pvalue, max_hit_pvalue, max_weak_pvalue, host, when)>
<!ELEMENT command_line (#PCDATA)>
<!ELEMENT max_correlation (#PCDATA)>
<!ELEMENT remove_correlated EMPTY>
<!ATTLIST remove_correlated value (y|n) #REQUIRED>
<!ELEMENT strand_handling EMPTY>
<!ATTLIST strand_handling value (combine|separate|norc|protein) #REQUIRED>
<!ELEMENT translate_dna EMPTY>
<!ATTLIST translate_dna value (y|n) #REQUIRED>
<!ELEMENT max_seq_evalue (#PCDATA)>
<!ELEMENT adj_hit_pvalue EMPTY>
<!ATTLIST adj_hit_pvalue value (y|n) #REQUIRED>
<!ELEMENT max_hit_pvalue (#PCDATA)>
<!ELEMENT max_weak_pvalue (#PCDATA)>
<!ELEMENT host (#PCDATA)>
<!ELEMENT when (#PCDATA)>
<!ELEMENT alphabet (letter+)>
<!ATTLIST alphabet type (amino-acid|nucleotide) #REQUIRED bg_source (preset|file|sequence_composition) #REQUIRED bg_file CDATA #IMPLIED>
<!ELEMENT letter EMPTY>
<!ATTLIST letter symbol CDATA #REQUIRED ambig (y|n) "n" bg_value CDATA #IMPLIED>
<!ELEMENT motifs (motif+,correlation*,nos*)>
<!ATTLIST motifs source CDATA #REQUIRED name CDATA #REQUIRED last_mod_date CDATA #REQUIRED>
<!ELEMENT motif EMPTY>
<!-- num is simply the loading order of the motif, it's superfluous but makes things easier for XSLT -->
<!ATTLIST motif id ID #REQUIRED num CDATA #REQUIRED name CDATA #REQUIRED width CDATA #REQUIRED
   best_f CDATA #REQUIRED best_r CDATA #IMPLIED bad (y|n) "n">
<!-- for n > 1 motifs there should be (n * (n - 1)) / 2 correlations, obviously there are none for only 1 motif -->
<!ELEMENT correlation EMPTY>
<!ATTLIST correlation motif_a IDREF #REQUIRED motif_b IDREF #REQUIRED value CDATA #REQUIRED>
<!-- nos: Nominal Order and Spacing diagram, a rarely used feature where mast can adjust pvalues for an expected motif spacing -->
<!ELEMENT nos (expect+)>
<!-- length is in the same unit as the motifs, which is not always the same unit as the sequence -->
<!ATTLIST nos length CDATA #REQUIRED>
<!-- the expect tags are expected to be ordered by pos ascending -->
<!ELEMENT expect EMPTY>
<!ATTLIST expect pos CDATA #REQUIRED gap CDATA #REQUIRED motif IDREF #REQUIRED>
<!ELEMENT sequences (database+, sequence*)>
<!-- the database tags are expected to be ordered in file specification order -->
<!ELEMENT database EMPTY>
<!ATTLIST database id ID #REQUIRED num CDATA #REQUIRED source CDATA #REQUIRED name CDATA #REQUIRED last_mod_date CDATA #REQUIRED 
    seq_count CDATA #REQUIRED residue_count CDATA #REQUIRED type (amino-acid|nucleotide) #REQUIRED link CDATA #IMPLIED>
<!-- the sequence tags are expected to be ordered by best combined p-value (of contained score tags) ascending -->
<!ELEMENT sequence (score+,seg*)>
<!ATTLIST sequence id ID #REQUIRED db IDREF #REQUIRED num CDATA #REQUIRED name CDATA #REQUIRED comment CDATA "" length CDATA #REQUIRED>
<!ELEMENT score EMPTY>


  [Part of this file has been deleted for brevity]

			<score strand="both" combined_pvalue="8.40e-03" evalue="0.15"/>
			<seg start="1">
				<data>
CCCATGAGAGTGAAATTGTTGTGATGTGGTTAACCCAATTAGAATTCGGGATTGACATGTCTTACCAAAAGGTAG
				</data>
				<hit pos="20" gap="19" motif="motif_1" pvalue="4.6e-05" strand="forward" match="+++++ ++++++ ++"/>
			</seg>
		</sequence>
		<sequence id="seq_1_5" db="db_1" num="5" name="cya" comment="" length="105">
			<score strand="both" combined_pvalue="9.17e-03" evalue="0.16"/>
			<seg start="1">
				<data>
ACGGTGCTACACTTGTATGTAGCGCATCTTTCTTTACGGTCAATCAGCAAGGTGTTAAATTGATCACGTTTTAGA
				</data>
				<hit pos="53" gap="52" motif="motif_1" pvalue="5.1e-05" strand="forward" match="+++ ++ + + ++++"/>
			</seg>
		</sequence>
		<sequence id="seq_1_2" db="db_1" num="2" name="ara" comment="" length="105">
			<score strand="both" combined_pvalue="9.99e-03" evalue="0.18"/>
			<seg start="1">
				<data>
GACAAAAACGCGTAACAAAAGTGTCTATAATCACGGCAGAAAAGTCCACATTGATTATTTGCACGGCGTCACACT
				</data>
				<hit pos="58" gap="57" motif="motif_1" pvalue="5.5e-05" strand="forward" match="+ ++ +++++ ++++"/>
			</seg>
		</sequence>
		<sequence id="seq_1_4" db="db_1" num="4" name="crp" comment="" length="105">
			<score strand="both" combined_pvalue="1.09e-02" evalue="0.2"/>
			<seg start="1">
				<data>
CACAAAGCGAAAGCTATGCTAAAACAGTCAGGATGCTACAGTAATACATTGATGTACTGCATGTATGCAAAGGAC
GTCACATTACCGTGCAGTACAGTTGATAGC
				</data>
				<hit pos="66" gap="65" motif="motif_1" pvalue="6.0e-05" strand="forward" match="++  ++++++ ++++"/>
			</seg>
		</sequence>
		<sequence id="seq_1_3" db="db_1" num="3" name="bglr1" comment="" length="105">
			<score strand="both" combined_pvalue="1.92e-02" evalue="0.35"/>
		</sequence>
		<sequence id="seq_1_11" db="db_1" num="11" name="malk" comment="" length="105">
			<score strand="both" combined_pvalue="3.23e-02" evalue="0.58"/>
		</sequence>
		<sequence id="seq_1_8" db="db_1" num="8" name="ilv" comment="" length="105">
			<score strand="both" combined_pvalue="5.93e-02" evalue="1.1"/>
		</sequence>
		<sequence id="seq_1_17" db="db_1" num="17" name="trn9cat" comment="" length="105">
			<score strand="both" combined_pvalue="1.14e-01" evalue="2"/>
		</sequence>
	</sequences>
	<runtime cycles="15997" seconds="0.016"/>
</mast>

MAST outputs a file containing:

Each section of the results file contains an explanation of how to interpret them.

Match Scores

The match score of a motif to a position in a sequence is the sum of the score from each column of the position-dependent scoring matrix corresponding to the letter at that position in the sequence. For example, if the sequence is
  
  TAATGTTGGTGCTGGTTTTTGTGGCATCGGGCGAGAATAGCGC
     ========
 
and the motif is represented by the position-dependent scoring matrix (where each row of the matrix corresponds to a position in the motif)
  
  =========|=================================
  POSITION |   A        C        G        T
  =========|=================================
    1      | 1.447    0.188   -4.025   -4.095 
    2      | 0.739    1.339   -3.945   -2.325 
    3      | 1.764   -3.562   -4.197   -3.895 
    4      | 1.574   -3.784   -1.594   -1.994 
    5      | 1.602   -3.935   -4.054   -1.370 
    6      | 0.797   -3.647   -0.814    0.215 
    7      |-1.280    1.873   -0.607   -1.933 
    8      |-3.076    1.035    1.414   -3.913 
  =========|=================================
then the match score of the fourth position in the sequence (underlined) would be found by summing the score for T in position 1, G in position 2 and so on until G in position 8. So the match score would be
    score = -4.095 + -3.945 + -3.895 + -1.994
            + -4.054 + -0.814 + -1.933 + 1.414 
          = -19.316
  
The match scores for other positions in the sequence are calculated in the same way. Match scores are only calculated if the match completely fits within the sequence. Match scores are not calculated if the motif would overhang either end of the sequence.

P-values

MAST reports all matches of a sequence to a motif or group of motifs in terms of the p-value of the match. MAST considers the p-values of four types of events: All p-values are based on a random sequence model that assumes each position in a random sequence is generated according to the average letter frequencies of all sequences in the the appropriate (peptide or nucleotide) non-redundant database (ftp://ncbi.nlm.nih.gov/blast/db/) on September 22, 1996. This can be overridden in two ways:

1) -bfile < bfile >

The random model uses the letter frequencies given in < bfile > instead of the non-redundant database frequencies. The format of < bfile > is the same as that for the MEME -bfile opton; see the MEME documentation for details. Sample files are given in directory tests: tests/nt.freq and tests/na.freq.)

2) -comp

The random model uses the letter frequencies in the current target sequence instead of the non-redundant database frequencies. This causes p-values and E-values to be compensated individually for the actual composition of each sequence in the database. This option can increase search time substantially due to the need to compute a different score distribution for each high-scoring sequence.

Position p-value

The p-value of a match of a given position within a sequence to a motif is defined as the probability of a randomly selected position in a randomly generated sequence having a match score at least as large as that of the given position.

Sequence p-value

The p-value of a match of a sequence to a motif is defined as the probability of a randomly generated sequence of the same length having a match score at least as large as the largest match score of any position in the sequence.

Combined p-value

The p-value of a match of a sequence to a group of motifs is defined as the probability of a randomly generated sequence of the same length having sequence p-values whose product is at least as small as the product of the sequence p-values of the matches of the motifs to the given sequence.

E-value

The E-value of the match of a sequence in a database to a a group of motifs is defined as the expected number of sequences in a random database of the same size that would match the motifs as well as the sequence does and is equal to the combined p-value of the sequence times the number of sequences in the database.

High-scoring Sequences

MAST lists the names and part of the descriptive text of all sequences whose E-value is less than E. Sequences shorter than one or more of the motifs are skipped. The sequences are sorted by increasing E-value. The value of E is set to 10 for the WEB server but is user-selectable in the down-loadable version of MAST.

Motif Diagrams

Motif diagrams show the order and spacing of non-overlapping matches to the motifs in each high-scoring sequence. Motif occurrences are determined based on the position p-value of matches to the motif. Strong matches (p-value < M) are shown in square brackets (`[ ]'), weak matches (M < p-value < M × 10) are shown in angle brackets (`< >') and the length of non-motif sequence ("spacer") is shown between dashes (`-'). For example,
  
          27-[3]-44-< 4 >-99-[1]-7
shows an initial spacer of length 27, followed by a strong match to motif 3, a spacer of length 44, a weak match to motif 4, a spacer of length 99, a strong match to motif 1 and a final non-motif sequence of length 7. The value of M is 0.0001 for the WEB server but is user-selectable in the down-loadable version of MAST.

Note: If you specify the -hit_list switch to MAST, the motif "diagram" takes the form of a comma separated list of motif occurrences ("hits"). Each "hit" has the format: < strand >< motif > < start > < end > < p-value > where

Annotated Sequences

MAST annotates each high-scoring sequence by printing the sequence along with the position and strength of all the non-overlapping motif occurrences. The four lines above each motif occurrence contain, respectively, The best possible match to a motif is the sequence of letters which would acheive the highest match score.

Data files

None.

Notes

1. Command-line arguments

The following original MEME options are not supported:
-stdout       : The output is always written to file.
-hit_list     : Use -hitlist instead. 

The following additional options are provided:

outfile       : Application output that was normally written to stdout.

2. Installing EMBASSY MEMENEW

The EMBASSY MEMENEW package contains "wrapper" applications providing an EMBOSS-style interface to the applications in the original MEME package version 4.4.0 developed by Timothy L. Bailey. Please read the file README in the EMBASSY MEMENEW package distribution for installation instructions.

3. Installing original MEME

To use EMBASSY MEMENEW, you will first need to download and install the original MEME package:
WWW home:       http://meme.sdsc.edu/meme/
Distribution:   http://meme.nbcr.net/downloads/old_versions/  
Please read the file README in the the original MEME package distribution for installation instructions.

4. Setting up MEME

For the EMBASSY MEMENEW package to work, the directory containing the original MEME executables *must* be in your path. For example if you executables were installed to "/usr/local/meme/bin", then type:
set path=(/usr/local/meme/bin/ $path)
rehash

5. Getting help

Once you have installed the original MEME, type
meme > meme.txt 
mast > mast.txt 
to retrieve the meme and mast documentation into text files. The same documentation is given here and in the ememe documentation.

Please read the 'Notes' section below for a description of the differences between the original and EMBASSY MEMENEW, particularly which application command line options are supported.

References

(MEME) Timothy L. Bailey and Charles Elkan, "Fitting a mixture model by expectation maximization to discover motifs in biopolymers", Proceedings of the Second International Conference on Intelligent Systems for Molecular Biology, pp. 28-36, AAAI Press, Menlo Park, California, 1994.

(MAST) Timothy L. Bailey and Michael Gribskov, "Combining evidence using p-values: application to sequence homology searches", Bioinformatics, Vol. 14, pp. 48-54, 1998.

Warnings

Diagnostic Error Messages

None.

Exit status

It always exits with status 0.

Known bugs

None.

See also

Program name Description
antigenic Find antigenic sites in proteins
eiprscan Motif detection
elipop Predict lipoproteins
ememe Multiple EM for motif elicitation
ememetext Multiple EM for motif elicitation, text file only
epestfind Find PEST motifs as potential proteolytic cleavage sites
fuzzpro Search for patterns in protein sequences
fuzztran Search for patterns in protein sequences (translated)
omeme Motif detection
patmatdb Search protein sequences with a sequence motif
patmatmotifs Scan a protein sequence with motifs from the PROSITE database
preg Regular expression search of protein sequence(s)
pscan Scan protein sequence(s) with fingerprints from the PRINTS database
sigcleave Report on signal cleavage sites in a protein sequence

Author(s)

This program is an EMBOSS conversion of a program written by Sean Eddy as part of his HMMER package.

Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author. Jon Ison
European Bioinformatics Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge CB10 1SD, UK

Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author.

This program is an EMBASSY wrapper to a program written by Timothy L. Bailey as part of his meme package.

Please report any bugs to the EMBOSS bug team in the first instance, not to Timothy L. Bailey.

History

None.

Target users

This program is intended to be used by everyone and everything, from naive users to embedded scripts.

Comments

None.