listor

 

Wiki

The master copies of EMBOSS documentation are available at http://emboss.open-bio.org/wiki/Appdocs on the EMBOSS Wiki.

Please help by correcting and extending the Wiki pages.

Function

Write a list file of the logical OR of two sets of sequences

Description

listor reads in two sets of sequences (typically specified as list files) and writes out a list file that result from the logical union of the two sets. A list file is a file with a list of Uniform Sequence Addresses (USAs), for example, a list of file names. When comparing sequences from the input sets, no use is made of the ID name or accession number; only the sequence itself is compared. The comparison of the sequences is case-independent. The logical union is an OR operation by default. Other available operations are: AND, XOR and NOT.

Algorithm

All the input sequences are kept in memory while the logical unions of the two input sets of sequences is calculated. listor is therefore restricted by the available memory.

Usage

Here is a sample session with listor

Write the logical OR of two lists:


% listor ../data/file2 
Write a list file of the logical OR of two sets of sequences
List of USAs output file [file1.list]: 

Go to the input files for this example
Go to the output files for this example

Example 2

Write the logical AND of two lists:


% listor ../data/file2 -operator and 
Write a list file of the logical OR of two sets of sequences
List of USAs output file [file1.list]: 

Go to the output files for this example

Example 3

Write the logical XOR of two lists:


% listor ../data/file2 -operator xor 
Write a list file of the logical OR of two sets of sequences
List of USAs output file [file1.list]: 

Go to the output files for this example

Example 4

Write the logical NOT of two lists:


% listor ../data/file2 -operator not 
Write a list file of the logical OR of two sets of sequences
List of USAs output file [file1.list]: 

Go to the output files for this example

Command line arguments

Write a list file of the logical OR of two sets of sequences
Version: EMBOSS:6.5.0.0

   Standard (Mandatory) qualifiers:
  [-firstsequences]    seqset     Sequence set filename and optional format,
                                  or reference (input USA)
  [-secondsequences]   seqset     Sequence set filename and optional format,
                                  or reference (input USA)
  [-outfile]           outfile    [*.listor] The list of sequence names will
                                  be written to this list file

   Additional (Optional) qualifiers:
   -operator           menu       [OR] The following logical operators combine
                                  the sequences in the following ways:
                                  OR - gives all that occur in one set or the
                                  other
                                  AND - gives only those which occur in both
                                  sets
                                  XOR - gives those which only occur in one
                                  set or the other, but not in both
                                  NOT - gives those which occur in the first
                                  set except for those that also occur in the
                                  second (Values: OR (OR - merger of both
                                  sets); AND (AND - only those in both sets);
                                  XOR (XOR - only those not in both sets); NOT
                                  (NOT - those of the first set that are not
                                  in the second))

   Advanced (Unprompted) qualifiers: (none)
   Associated qualifiers:

   "-firstsequences" associated qualifiers
   -sbegin1            integer    Start of each sequence to be used
   -send1              integer    End of each sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -scircular1         boolean    Sequence is circular
   -sformat1           string     Input sequence format
   -iquery1            string     Input query fields or ID list
   -ioffset1           integer    Input start position offset
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name

   "-secondsequences" associated qualifiers
   -sbegin2            integer    Start of each sequence to be used
   -send2              integer    End of each sequence to be used
   -sreverse2          boolean    Reverse (if DNA)
   -sask2              boolean    Ask for begin/end/reverse
   -snucleotide2       boolean    Sequence is nucleotide
   -sprotein2          boolean    Sequence is protein
   -slower2            boolean    Make lower case
   -supper2            boolean    Make upper case
   -scircular2         boolean    Sequence is circular
   -sformat2           string     Input sequence format
   -iquery2            string     Input query fields or ID list
   -ioffset2           integer    Input start position offset
   -sdbname2           string     Database name
   -sid2               string     Entryname
   -ufo2               string     UFO features
   -fformat2           string     Features format
   -fopenfile2         string     Features file name

   "-outfile" associated qualifiers
   -odirectory3        string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write first file to standard output
   -filter             boolean    Read first file from standard input, write
                                  first file to standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options and exit. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages
   -version            boolean    Report version number and exit

Qualifier Type Description Allowed values Default
Standard (Mandatory) qualifiers
[-firstsequences]
(Parameter 1)
seqset Sequence set filename and optional format, or reference (input USA) Readable set of sequences Required
[-secondsequences]
(Parameter 2)
seqset Sequence set filename and optional format, or reference (input USA) Readable set of sequences Required
[-outfile]
(Parameter 3)
outfile The list of sequence names will be written to this list file Output file <*>.listor
Additional (Optional) qualifiers
-operator list The following logical operators combine the sequences in the following ways: OR - gives all that occur in one set or the other AND - gives only those which occur in both sets XOR - gives those which only occur in one set or the other, but not in both NOT - gives those which occur in the first set except for those that also occur in the second
OR (OR - merger of both sets)
AND (AND - only those in both sets)
XOR (XOR - only those not in both sets)
NOT (NOT - those of the first set that are not in the second)
OR
Advanced (Unprompted) qualifiers
(none)
Associated qualifiers
"-firstsequences" associated seqset qualifiers
-sbegin1
-sbegin_firstsequences
integer Start of each sequence to be used Any integer value 0
-send1
-send_firstsequences
integer End of each sequence to be used Any integer value 0
-sreverse1
-sreverse_firstsequences
boolean Reverse (if DNA) Boolean value Yes/No N
-sask1
-sask_firstsequences
boolean Ask for begin/end/reverse Boolean value Yes/No N
-snucleotide1
-snucleotide_firstsequences
boolean Sequence is nucleotide Boolean value Yes/No N
-sprotein1
-sprotein_firstsequences
boolean Sequence is protein Boolean value Yes/No N
-slower1
-slower_firstsequences
boolean Make lower case Boolean value Yes/No N
-supper1
-supper_firstsequences
boolean Make upper case Boolean value Yes/No N
-scircular1
-scircular_firstsequences
boolean Sequence is circular Boolean value Yes/No N
-sformat1
-sformat_firstsequences
string Input sequence format Any string  
-iquery1
-iquery_firstsequences
string Input query fields or ID list Any string  
-ioffset1
-ioffset_firstsequences
integer Input start position offset Any integer value 0
-sdbname1
-sdbname_firstsequences
string Database name Any string  
-sid1
-sid_firstsequences
string Entryname Any string  
-ufo1
-ufo_firstsequences
string UFO features Any string  
-fformat1
-fformat_firstsequences
string Features format Any string  
-fopenfile1
-fopenfile_firstsequences
string Features file name Any string  
"-secondsequences" associated seqset qualifiers
-sbegin2
-sbegin_secondsequences
integer Start of each sequence to be used Any integer value 0
-send2
-send_secondsequences
integer End of each sequence to be used Any integer value 0
-sreverse2
-sreverse_secondsequences
boolean Reverse (if DNA) Boolean value Yes/No N
-sask2
-sask_secondsequences
boolean Ask for begin/end/reverse Boolean value Yes/No N
-snucleotide2
-snucleotide_secondsequences
boolean Sequence is nucleotide Boolean value Yes/No N
-sprotein2
-sprotein_secondsequences
boolean Sequence is protein Boolean value Yes/No N
-slower2
-slower_secondsequences
boolean Make lower case Boolean value Yes/No N
-supper2
-supper_secondsequences
boolean Make upper case Boolean value Yes/No N
-scircular2
-scircular_secondsequences
boolean Sequence is circular Boolean value Yes/No N
-sformat2
-sformat_secondsequences
string Input sequence format Any string  
-iquery2
-iquery_secondsequences
string Input query fields or ID list Any string  
-ioffset2
-ioffset_secondsequences
integer Input start position offset Any integer value 0
-sdbname2
-sdbname_secondsequences
string Database name Any string  
-sid2
-sid_secondsequences
string Entryname Any string  
-ufo2
-ufo_secondsequences
string UFO features Any string  
-fformat2
-fformat_secondsequences
string Features format Any string  
-fopenfile2
-fopenfile_secondsequences
string Features file name Any string  
"-outfile" associated outfile qualifiers
-odirectory3
-odirectory_outfile
string Output directory Any string  
General qualifiers
-auto boolean Turn off prompts Boolean value Yes/No N
-stdout boolean Write first file to standard output Boolean value Yes/No N
-filter boolean Read first file from standard input, write first file to standard output Boolean value Yes/No N
-options boolean Prompt for standard and additional values Boolean value Yes/No N
-debug boolean Write debug output to program.dbg Boolean value Yes/No N
-verbose boolean Report some/full command line options Boolean value Yes/No Y
-help boolean Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose Boolean value Yes/No N
-warning boolean Report warnings Boolean value Yes/No Y
-error boolean Report errors Boolean value Yes/No Y
-fatal boolean Report fatal errors Boolean value Yes/No Y
-die boolean Report dying program messages Boolean value Yes/No Y
-version boolean Report version number and exit Boolean value Yes/No N

Input file format

The input sets of sequences can be of any valid USAs. The program was written to perform logical operations on list files, but in practice, wildcarded database entries and file names are also perfectly legal specifications of the input sequences.

Input files for usage example

File: file1

>one
tagctagcg
>two
tagctagcggctacgt
>three
tagctattttatgctacgtcagtgac

File: file2

>two
tagctagcggctacgt
>three
tagctattttatgctacgtcagtgac
>four
gcgcggcgcgcgtgcgtcgttgctggggccc

Output file format

The output is simply a list of the USAs (format and sequence specification) resulting from the required logical union of the two sets of input sequence.

The order that the USAs are written out is not necessarily the same as the order of either of the input sets of sequences.

The results of the four types of logical union follows. Note that the duplicated sequences in these two files have been given the same name. This is not necessary for the operation of listor as it compares the sequences themselves, not the ID names of the sequences.

Output files for usage example

File: file1.list

fasta::../../data/file1:one
fasta::../../data/file1:two
fasta::../../data/file1:three
fasta::../../data/file2:four

Output files for usage example 2

File: file1.list

fasta::../../data/file1:two
fasta::../../data/file1:three

Output files for usage example 3

File: file1.list

fasta::../../data/file1:one
fasta::../../data/file2:four

Output files for usage example 4

File: file1.list

fasta::../../data/file1:one

Data files

None.

Notes

The inputs can be any valid USA but typically reference a list file. Some other reference such as a wildcarded database entries or file name are equally valid.

The (default) logical OR of the two sets of sequences is simply the result of merging the two sets of sequences. A sequences appearing in both input sets is referenced once only in the output file. A logical AND simply lists those sequences that occur in both sets of sequences.

A logical XOR lists those sequences that ONLY occur in the first set or only occur in the second set - sequences occuring in both sets are omitted (the opposite of an AND).

A logical NOT lists all those sequences in the first set except for those that also occur in the second set.

References

None.

Warnings

listor is restricted by the available memory. Doing logical unions involving all of the sequences in large databases, such as EMBL, is probably impractical unless you are lucky enough to have extraordinary amounts of memory on your machine.

Diagnostic Error Messages

None.

Exit status

It always exits with status 0.

Known bugs

None.

See also

Program name Description
aligncopy Read and write alignments
aligncopypair Read and write pairs from alignments
biosed Replace or delete sequence sections
codcopy Copy and reformat a codon usage table
cutseq Remove a section from a sequence
degapseq Remove non-alphabetic (e.g. gap) characters from sequences
descseq Alter the name or description of a sequence
entret Retrieve sequence entries from flatfile databases and files
extractalign Extract regions from a sequence alignment
extractfeat Extract features from sequence(s)
extractseq Extract regions from a sequence
featcopy Read and write a feature table
featmerge Merge two overlapping feature tables
featreport Read and write a feature table
feattext Return a feature table original text
makenucseq Create random nucleotide sequences
makeprotseq Create random protein sequences
maskambignuc Mask all ambiguity characters in nucleotide sequences with N
maskambigprot Mask all ambiguity characters in protein sequences with X
maskfeat Write a sequence with masked features
maskseq Write a sequence with masked regions
newseq Create a sequence file from a typed-in sequence
nohtml Remove mark-up (e.g. HTML tags) from an ASCII text file
noreturn Remove carriage return from ASCII files
nospace Remove whitespace from an ASCII text file
notab Replace tabs with spaces in an ASCII text file
notseq Write to file a subset of an input stream of sequences
nthseq Write to file a single sequence from an input stream of sequences
nthseqset Read and write (return) one set of sequences from many
pasteseq Insert one sequence into another
revseq Reverse and complement a nucleotide sequence
seqcount Read and count sequences
seqret Read and write (return) sequences
seqretsetall Read and write (return) many sets of sequences
seqretsplit Read sequences and write them to individual files
sizeseq Sort sequences by size
skipredundant Remove redundant sequences from an input set
skipseq Read and write (return) sequences, skipping first few
splitsource Split sequence(s) into original source sequences
splitter Split sequence(s) into smaller sequences
trimest Remove poly-A tails from nucleotide sequences
trimseq Remove unwanted characters from start and end of sequence(s)
trimspace Remove extra whitespace from an ASCII text file
union Concatenate multiple sequences into a single sequence
vectorstrip Remove vectors from the ends of nucleotide sequence(s)
yank Add a sequence reference (a full USA) to a list file

Author(s)

Gary Williams formerly at:
MRC Rosalind Franklin Centre for Genomics Research Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SB, UK

Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author.

History

Written (1 Aug 2001) - Gary Williams

Target users

This program is intended to be used by everyone and everything, from naive users to embedded scripts.

Comments

None