vectorstrip

Wiki

Please help by correcting and extending the Wiki pages.

Function

Description

vectorstrip reads one or more nucleotide sequences and writes them out again but with any of a specified set of vector sequences removed from the 5' and 3' termini. An output file with a summary of the results is also written. The vector sequences to strip out are (typically) provided in an input file. The pair of 5' and 3' vector sequences are searched against each input sequence allowing a specified maximum level of mismatches. Each 5' hit is paired with each 3' hit and the resulting subsequences output. By default only the best match between the vector patterns and each sequence are reported. Optionally, all matches up to the specified maximum mismatch level are reported.

Usage

% vectorstrip @vecseqs.list Remove vectors from the ends of nucleotide sequence(s) Are your vector sequences in a file? [Y]: Cloning vector definition file (optional): vectors Max allowed % mismatch [10]: Show only the best hits (minimise mismatches)? [Y]: Output file [pbluescript.vectorstrip]: vector.strip output sequence(s) [pbluescript.fasta]: vector.fasta

Go to the input files for this example
Go to the output files for this example

Command line arguments

Remove vectors from the ends of nucleotide sequence(s)
Version: EMBOSS:6.5.0.0

   Standard (Mandatory) qualifiers (* if not always prompted):
  [-sequence]          seqall     Nucleotide sequence(s) filename and optional
                                  format, or reference (input USA)
  [-[no]readfile]      toggle     [Y] Are your vector sequences in a file?
*  -vectorsfile        infile     Cloning vector definition file (optional)
   -mismatch           integer    [10] Max allowed % mismatch (Any integer
                                  value)
   -[no]besthits       boolean    [Y] Show only the best hits (minimise
                                  mismatches)?
*  -alinker            string     The 5' sequence (Any string)
*  -blinker            string     The 3' sequence (Any string)
  [-outfile]           outfile    [*.vectorstrip] Output file name
  [-outseq]            seqoutall  [.] Sequence set(s)
                                  filename and optional format (output USA)

   Additional (Optional) qualifiers:
   -allsequences       boolean    [N] Show all sequences in output

   Advanced (Unprompted) qualifiers: (none)
   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin1            integer    Start of each sequence to be used
   -send1              integer    End of each sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -scircular1         boolean    Sequence is circular
   -sformat1           string     Input sequence format
   -iquery1            string     Input query fields or ID list
   -ioffset1           integer    Input start position offset
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name

   "-outfile" associated qualifiers
   -odirectory3        string     Output directory

   "-outseq" associated qualifiers
   -osformat4          string     Output seq format
   -osextension4       string     File name extension
   -osname4            string     Base file name
   -osdirectory4       string     Output directory
   -osdbname4          string     Database name to add
   -ossingle4          boolean    Separate file for each entry
   -oufo4              string     UFO features
   -offormat4          string     Features format
   -ofname4            string     Features file name
   -ofdirectory4       string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write first file to standard output
   -filter             boolean    Read first file from standard input, write
                                  first file to standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options and exit. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages
   -version            boolean    Report version number and exit

Qualifier	Type	Description	Allowed values	Default
Standard (Mandatory) qualifiers
[-sequence] (Parameter 1)	seqall	Nucleotide sequence(s) filename and optional format, or reference (input USA)	Readable sequence(s)	Required
[-[no]readfile] (Parameter 2)	toggle	Are your vector sequences in a file?	Toggle value Yes/No	Yes
-vectorsfile	infile	Cloning vector definition file (optional)	Input file	Required
-mismatch	integer	Max allowed % mismatch	Any integer value	10
-[no]besthits	boolean	Show only the best hits (minimise mismatches)?	Boolean value Yes/No	Yes
-alinker	string	The 5' sequence	Any string
-blinker	string	The 3' sequence	Any string
[-outfile] (Parameter 3)	outfile	Output file name	Output file	<*>.vectorstrip
[-outseq] (Parameter 4)	seqoutall	Sequence set(s) filename and optional format (output USA)	Writeable sequence(s)	<*>.format
Additional (Optional) qualifiers
-allsequences	boolean	Show all sequences in output	Boolean value Yes/No	No
Advanced (Unprompted) qualifiers
(none)
Associated qualifiers
"-sequence" associated seqall qualifiers
-sbegin1 -sbegin_sequence	integer	Start of each sequence to be used	Any integer value	0
-send1 -send_sequence	integer	End of each sequence to be used	Any integer value	0
-sreverse1 -sreverse_sequence	boolean	Reverse (if DNA)	Boolean value Yes/No	N
-sask1 -sask_sequence	boolean	Ask for begin/end/reverse	Boolean value Yes/No	N
-snucleotide1 -snucleotide_sequence	boolean	Sequence is nucleotide	Boolean value Yes/No	N
-sprotein1 -sprotein_sequence	boolean	Sequence is protein	Boolean value Yes/No	N
-slower1 -slower_sequence	boolean	Make lower case	Boolean value Yes/No	N
-supper1 -supper_sequence	boolean	Make upper case	Boolean value Yes/No	N
-scircular1 -scircular_sequence	boolean	Sequence is circular	Boolean value Yes/No	N
-sformat1 -sformat_sequence	string	Input sequence format	Any string
-iquery1 -iquery_sequence	string	Input query fields or ID list	Any string
-ioffset1 -ioffset_sequence	integer	Input start position offset	Any integer value	0
-sdbname1 -sdbname_sequence	string	Database name	Any string
-sid1 -sid_sequence	string	Entryname	Any string
-ufo1 -ufo_sequence	string	UFO features	Any string
-fformat1 -fformat_sequence	string	Features format	Any string
-fopenfile1 -fopenfile_sequence	string	Features file name	Any string
"-outfile" associated outfile qualifiers
-odirectory3 -odirectory_outfile	string	Output directory	Any string
"-outseq" associated seqoutall qualifiers
-osformat4 -osformat_outseq	string	Output seq format	Any string
-osextension4 -osextension_outseq	string	File name extension	Any string
-osname4 -osname_outseq	string	Base file name	Any string
-osdirectory4 -osdirectory_outseq	string	Output directory	Any string
-osdbname4 -osdbname_outseq	string	Database name to add	Any string
-ossingle4 -ossingle_outseq	boolean	Separate file for each entry	Boolean value Yes/No	N
-oufo4 -oufo_outseq	string	UFO features	Any string
-offormat4 -offormat_outseq	string	Features format	Any string
-ofname4 -ofname_outseq	string	Features file name	Any string
-ofdirectory4 -ofdirectory_outseq	string	Output directory	Any string
General qualifiers
-auto	boolean	Turn off prompts	Boolean value Yes/No	N
-stdout	boolean	Write first file to standard output	Boolean value Yes/No	N
-filter	boolean	Read first file from standard input, write first file to standard output	Boolean value Yes/No	N
-options	boolean	Prompt for standard and additional values	Boolean value Yes/No	N
-debug	boolean	Write debug output to program.dbg	Boolean value Yes/No	N
-verbose	boolean	Report some/full command line options	Boolean value Yes/No	Y
-help	boolean	Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose	Boolean value Yes/No	N
-warning	boolean	Report warnings	Boolean value Yes/No	Y
-error	boolean	Report errors	Boolean value Yes/No	Y
-fatal	boolean	Report fatal errors	Boolean value Yes/No	Y
-die	boolean	Report dying program messages	Boolean value Yes/No	Y
-version	boolean	Report version number and exit	Boolean value Yes/No	N

Input file format

Input files for usage example

File: vecseqs.list

../../data/bluescript.seq
../../data/litmus.seq
../../data/pTYB1.seq

File: vectors

# Example vector file for use by vectorstrip

# Vector	5'			3'

pTYB1   GACGGCGGCCGCGAATTCC     TCGAGGGCTCTTCCTGC
pBS_KS+ GGGTACCGGGCCCCCCC       TCGAGGTCGACGGTA         
pLITMUS GATATCCTGCAGGAATTCC     TCGAGACCGTACGTGCG

The same fragment has been cloned into the XhoI site of the polylinker of each vector. The cloned fragment is represented in lower case and the vector sequence in upper case so the sequence trimming can be readily seen.

Each line of the vector file should contain the name of the vector, the 5' pattern and the 3' pattern.
Lines beginning with # are treated as comments and ignored.
If only one vector sequence is given in the it will be assumed that this is the 5' pattern.
If a vector name is given but no pattern data, the vector will not be used.

Output file format

Output files for usage example

File: vector.strip

Sequence: pBlueScript 	 Vector: pTYB1	No match


Sequence: pBlueScript 	 Vector: pBS_KS+
5' sequence matches:
	From 67 to 83 with 0 mismatches
3' sequence matches:
	From 205 to 219 with 0 mismatches
Sequences output to file:
	from 84 to 204
		tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagca
		cacagtgacatgagagacacagatatagagacagatagacgatagacaga
		cagcatatatagacagatagc
	sequence trimmed from 5' end:
		GGAAACAGCTAATGACCATGATTACGCCAAGCGCGCAATTAACCCTCACT
		AAAGGGAACAAAAGCTGGGTACCGGGCCCCCCC
	sequence trimmed from 3' end:
		TCGAGGTCGACGGTATCGATAAGCTTGATATCG


Sequence: pBlueScript 	 Vector: pLITMUS	No match

Sequence: litmus.seq 	 Vector: pTYB1	No match

Sequence: litmus.seq 	 Vector: pBS_KS+	No match


Sequence: litmus.seq 	 Vector: pLITMUS
5' sequence matches:
	From 43 to 61 with 0 mismatches
3' sequence matches:
	From 183 to 199 with 0 mismatches
Sequences output to file:
	from 62 to 182
		tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagca
		cacagtgacatgagagacacagatatagagacagatagacgatagacaga
		cagcatatatagacagatagc
	sequence trimmed from 5' end:
		TCTAGAACCGGTGACGTCTCCCATGGTGAAGCTTGGATCCACGATATCCT
		GCAGGAATTCC
	sequence trimmed from 3' end:
		TCGAGACCGTACGTGCGCGCGAATGCATCCAGATCTTCCCTCTAGTCAAG
		GCCTTAAGTGAGTCGTATTACGGA



Sequence: pTYB1.seq 	 Vector: pTYB1
5' sequence matches:
	From 40 to 58 with 0 mismatches
3' sequence matches:
	From 180 to 196 with 0 mismatches
Sequences output to file:
	from 59 to 179
		tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagca
		cacagtgacatgagagacacagatatagagacagatagacgatagacaga
		cagcatatatagacagatagc
	sequence trimmed from 5' end:
		CTTTAAGAAGGAGATATACATATGGCTAGCTCGCGAGTCGACGGCGGCCG
		CGAATTCC
	sequence trimmed from 3' end:
		TCGAGGGCTCTTCCTGCTTTGCCAAGGGTACCAATGTTTTAATGGCGGAT


Sequence: pTYB1.seq 	 Vector: pBS_KS+	No match

Sequence: pTYB1.seq 	 Vector: pLITMUS	No match

File: vector.fasta

>pBlueScript_from_84_to_204 KS+
tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagcacacagtgaca
tgagagacacagatatagagacagatagacgatagacagacagcatatatagacagatag
c
>litmus.seq_from_62_to_182
tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagcacacagtgaca
tgagagacacagatatagagacagatagacgatagacagacagcatatatagacagatag
c
>pTYB1.seq_from_59_to_179
tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagcacacagtgaca
tgagagacacagatatagagacagatagacgatagacagacagcatatatagacagatag
c

Two types of output file are produced:

1. The sequence file(s) - contain the trimmed subsequence(s) produced by vectorstrip either all in one file, or in separate files if the command line flag -ossingle is used.
2. Results summary file

Data files

Notes

vectorstrip is intended for stripping vector sequence from the ends of sequences of interest. For example, if a fragment has been cloned into a vector and then sequenced, the sequence may contain vector data eg from the cloning polylinker at the 5' and 3' ends of the sequence. vectorstrip will remove these contaminating regions and output trimmed sequence ready for input into another application.

vectorstrip is suitable for use with low quality sequence data as it can allow for mismatches between the sequence and the vector patterns provided. You can specify the maximum level of mismatch expected.

Vector data can either be provided in a file or interactively. If presented in a file, vectorstrip will search all input sequences with all vectors listed in that file. The intention is that the user can maintain a single file for use with vectorstrip, containing all the linker sequences commonly used in the laboratory.

The two patterns for each vector are searched separately against the sequence. Once the search is completed, each of the hits of the 5' sequence is paired with each of the hits of the 3' sequence and the resulting subsequences are output. For example, if the 5' sequence matches the sequence from (a) position 30-60, and(b)position 70-100, and the 3' sequence matches from 150-175, then two subsequences will be output: from 61-149, and from 101-149. The lower the quality of the sequence, the more likely multiple hits become if nonzero mismatches are accepted.

Default behaviour is to report only the best matches between the vector patterns and the sequence. This means that if you specify a maximum mismatch level of 10%, but the vector patterns match the sequence with zero mismatches, the search will stop and the program will output only these "best" matches. If there are no perfect matches, the program will try searching again allowing 1 mismatch, then 2, and so on until either the patterns match the sequence or the maximum specified mismatch level is exceeded. You can tell vectorstrip to show all possible matches up to your specified maximum level, as illustrated in the examples below.

References

Warnings

Diagnostic Error Messages

1. No suitable vectors found - exiting

   indicates that the 5' and 3' patterns for the vectors were blank - usually this is as a result of an empty vectorfile.

2. Illegal pattern

   indicates that one of the vector patterns could not be compiled and therefore cannot be searched.

3. 5' and 3' sequence matches are identical; inconclusive

   indicates that the 5' and 3' patterns provided were identical, and that they only match the sequence once. Thus the program cannot determine which part of the sequence is vector and which is insert.

Exit status

Known bugs

See also

Author(s)

Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author.

History

Target users

Comments