ovrnasubopt

Wiki

Please help by correcting and extending the Wiki pages.

Function

Description

This is a port of the Vienna RNA package program RNAsubopt.

It reads RNA sequences and calculates all suboptimal secondary structures within a user-defined energy range above the minimum free energy (mfe). It prints the suboptimal structures in bracket notation followed by the energy in kcal/mol to stdout.

Optionally, it will produce Boltzmann weighted samples of secondary structures.

Algorithm

Usage

% ovrnasubopt Calculate suboptimal secondary structure of RNA Input nucleotide sequence: rna1.seq Vienna RNAfold output file [rna1.ovrnasubopt]:

Go to the input files for this example
Go to the output files for this example

Command line arguments

Calculate suboptimal secondary structure of RNA
Version: EMBOSS:6.5.0.0

   Standard (Mandatory) qualifiers:
  [-sequence]          sequence   Nucleotide sequence filename and optional
                                  format, or reference (input USA)
  [-outfile]           outfile    [*.ovrnasubopt] Vienna RNAfold output file

   Additional (Optional) qualifiers: (none)
   Advanced (Unprompted) qualifiers:
   -constraintfile     infile     Vienna RNA structure constraints file
                                  (optional)
   -paramfile          infile     Vienna RNA parameters file (optional)
   -temperature        float      [37.0] Temperature (Any numeric value)
   -circular           boolean    [N] Allow circular RNA
   -dos                boolean    [N] DOS special corrections
   -[no]gu             boolean    [Y] Allow GU pairs
   -[no]closegu        boolean    [Y] Allow GU pairs at end of helices
   -[no]lp             boolean    [Y] Allow lonely pairs
   -[no]convert        boolean    [Y] Convert T to U
   -nsbases            string     Non-standard bases (Any string)
   -[no]tetraloop      boolean    [Y] Stabilizing energies for tetra-loops
   -erange             float      [1.0] Calculate suboptimal structures within
                                  erange of the mfe (Any numeric value)
   -prange             float      [0.0] Only print structures with energy
                                  within prange of the mfe (Any numeric value)
   -sort               boolean    [N] Sort structures by energy
   -logml              boolean    [N] Logarithmic energy function for
                                  multi-loops
   -dangles            menu       [2] Method (Values: 0 (Ignore); 1 (Only
                                  unpaired bases for just one dangling end); 2
                                  (Always use dangling energies); 3 (Allow
                                  coaxial stacking of adjacent helices))
   -nrandom            integer    [0] Number of random suboptimal structures
                                  (Any integer value)

   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin1            integer    Start of the sequence to be used
   -send1              integer    End of the sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -scircular1         boolean    Sequence is circular
   -sformat1           string     Input sequence format
   -iquery1            string     Input query fields or ID list
   -ioffset1           integer    Input start position offset
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name

   "-outfile" associated qualifiers
   -odirectory2        string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write first file to standard output
   -filter             boolean    Read first file from standard input, write
                                  first file to standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options and exit. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages
   -version            boolean    Report version number and exit

Qualifier	Type	Description	Allowed values	Default
Standard (Mandatory) qualifiers
[-sequence] (Parameter 1)	sequence	Nucleotide sequence filename and optional format, or reference (input USA)	Readable sequence	Required
[-outfile] (Parameter 2)	outfile	Vienna RNAfold output file	Output file	<*>.ovrnasubopt
Additional (Optional) qualifiers
(none)
Advanced (Unprompted) qualifiers
-constraintfile	infile	Vienna RNA structure constraints file (optional)	Input file	Required
-paramfile	infile	Vienna RNA parameters file (optional)	Input file	Required
-temperature	float	Temperature	Any numeric value	37.0
-circular	boolean	Allow circular RNA	Boolean value Yes/No	No
-dos	boolean	DOS special corrections	Boolean value Yes/No	No
-[no]gu	boolean	Allow GU pairs	Boolean value Yes/No	Yes
-[no]closegu	boolean	Allow GU pairs at end of helices	Boolean value Yes/No	Yes
-[no]lp	boolean	Allow lonely pairs	Boolean value Yes/No	Yes
-[no]convert	boolean	Convert T to U	Boolean value Yes/No	Yes
-nsbases	string	Non-standard bases	Any string
-[no]tetraloop	boolean	Stabilizing energies for tetra-loops	Boolean value Yes/No	Yes
-erange	float	Calculate suboptimal structures within erange of the mfe	Any numeric value	1.0
-prange	float	Only print structures with energy within prange of the mfe	Any numeric value	0.0
-sort	boolean	Sort structures by energy	Boolean value Yes/No	No
-logml	boolean	Logarithmic energy function for multi-loops	Boolean value Yes/No	No
-dangles	list	Method	0 (Ignore) 1 (Only unpaired bases for just one dangling end) 2 (Always use dangling energies) 3 (Allow coaxial stacking of adjacent helices)	2
-nrandom	integer	Number of random suboptimal structures	Any integer value	0
Associated qualifiers
"-sequence" associated sequence qualifiers
-sbegin1 -sbegin_sequence	integer	Start of the sequence to be used	Any integer value	0
-send1 -send_sequence	integer	End of the sequence to be used	Any integer value	0
-sreverse1 -sreverse_sequence	boolean	Reverse (if DNA)	Boolean value Yes/No	N
-sask1 -sask_sequence	boolean	Ask for begin/end/reverse	Boolean value Yes/No	N
-snucleotide1 -snucleotide_sequence	boolean	Sequence is nucleotide	Boolean value Yes/No	N
-sprotein1 -sprotein_sequence	boolean	Sequence is protein	Boolean value Yes/No	N
-slower1 -slower_sequence	boolean	Make lower case	Boolean value Yes/No	N
-supper1 -supper_sequence	boolean	Make upper case	Boolean value Yes/No	N
-scircular1 -scircular_sequence	boolean	Sequence is circular	Boolean value Yes/No	N
-sformat1 -sformat_sequence	string	Input sequence format	Any string
-iquery1 -iquery_sequence	string	Input query fields or ID list	Any string
-ioffset1 -ioffset_sequence	integer	Input start position offset	Any integer value	0
-sdbname1 -sdbname_sequence	string	Database name	Any string
-sid1 -sid_sequence	string	Entryname	Any string
-ufo1 -ufo_sequence	string	UFO features	Any string
-fformat1 -fformat_sequence	string	Features format	Any string
-fopenfile1 -fopenfile_sequence	string	Features file name	Any string
"-outfile" associated outfile qualifiers
-odirectory2 -odirectory_outfile	string	Output directory	Any string
General qualifiers
-auto	boolean	Turn off prompts	Boolean value Yes/No	N
-stdout	boolean	Write first file to standard output	Boolean value Yes/No	N
-filter	boolean	Read first file from standard input, write first file to standard output	Boolean value Yes/No	N
-options	boolean	Prompt for standard and additional values	Boolean value Yes/No	N
-debug	boolean	Write debug output to program.dbg	Boolean value Yes/No	N
-verbose	boolean	Report some/full command line options	Boolean value Yes/No	Y
-help	boolean	Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose	Boolean value Yes/No	N
-warning	boolean	Report warnings	Boolean value Yes/No	Y
-error	boolean	Report errors	Boolean value Yes/No	Y
-fatal	boolean	Report fatal errors	Boolean value Yes/No	Y
-die	boolean	Report dying program messages	Boolean value Yes/No	Y
-version	boolean	Report version number and exit	Boolean value Yes/No	N

Input file format

Input files for usage example

File: rna1.seq

>rna1
CACUACUCCAAGGACCGUAUCUUUCUCAGUGCGACAGUAA

Output file format

Output files for usage example

File: rna1.ovrnasubopt

> rna1 [100]
CACUACUCCAAGGACCGUAUCUUUCUCAGUGCGACAGUAA   -380    100
...(((((....)).((((.((.....))))))...))).  -2.80
...(((((....)).(((((........)))))...))).  -3.80
...(((((....)..(((((........)))))..)))).  -3.10
.(((..((....)).((((.((.....))))))..)))..  -2.80
.(((..((....)).(((((........)))))..)))..  -3.80
......((....)).(((((........))))).......  -3.10
...............(((((........))))).......  -3.30

Data files

Notes

References

Warnings

Diagnostic Error Messages

Exit status

Known bugs

See also

Author(s)

Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author.

History

Target users

Comments