vrnaalifold

 

Wiki

The master copies of EMBOSS documentation are available at http://emboss.open-bio.org/wiki/Appdocs on the EMBOSS Wiki.

Please help by correcting and extending the Wiki pages.

Function

Calculate secondary structures for a set of aligned RNAs

Description

This is a port of the Vienna RNA package program RNAalifold.

It reads aligned RNA sequences and calculates their minimum free energy (mfe) structure. It returns the mfe structure in bracket notation, its energy, the free energy of the thermodynamic ensemble and the frequency of the mfe structure in the ensemble. It also produces plots of the resulting secondary structure graph and a "dot plot" of the base pairing matrix.

The original program produces different outputs, depending on the options selected. In the EMBASSY implementation it is split into vrnaalifold and vrnaalifoldpf

Algorithm

See the original documentation for the Vienna RNA package http://www.tbi.univie.ac.at/~ivo/RNA/

Usage

Here is a sample session with vrnaalifold 


% vrnaalifold 
Calculate secondary structures for a set of aligned RNAs
Input (aligned) nucleotide sequence set: ecoli6s.fasta
Vienna RNAfold output file [ecoli6s.vrnaalifold]:

Go to the input files for this example
Go to the output files for this example

Command line arguments 

Calculate secondary structures for a set of aligned RNAs
Version: EMBOSS:6.6.0.0

   Standard (Mandatory) qualifiers:
  [-sequence]          seqset     (Aligned) nucleotide sequence set filename
                                  and optional format, or reference (input
                                  USA)
  [-outfile]           outfile    [*.vrnaalifold] Vienna RNAfold output file

   Additional (Optional) qualifiers: (none)
   Advanced (Unprompted) qualifiers:
   -constraintfile     infile     Vienna RNA structure constraints file
                                  (optional)
   -paramfile          infile     Vienna RNA parameters file (optional)
   -rsumfile           infile     Vienna RNA Ribosum file (optional)
   -temperature        float      [37.0] Temperature (Any numeric value)
   -[no]gu             boolean    [Y] Allow GU pairs
   -[no]closegu        boolean    [Y] Allow GU pairs at end of helices
   -[no]lp             boolean    [Y] Allow lonely pairs
   -[no]convert        boolean    [Y] Convert T to U
   -nsbases            string     Non-standard bases (Any string)
   -[no]tetraloop      boolean    [Y] Stabilizing energies for tetra-loops
   -circular           boolean    [N] Circular RNA
   -colour             boolean    [N] Colour structure plot
   -[no]alnps          boolean    [Y] Produce alignment postscript
   -energy             menu       [0] Rarely used option to fold sequences
                                  from the ABCD... alphabet (Values: 0 (BP); 1
                                  (Any with GC); 2 (Any with AU parameters))
   -scale              float      [1.07] Estimate of ensemble free energy (Any
                                  numeric value)
   -dangles            menu       [2] Method (Values: 0 (Ignore); 1 (Only
                                  unpaired bases for just one dangling end); 2
                                  (Always use dangling energies); 3 (Allow
                                  coaxial stacking of adjacent helices))
   -covariance         float      [1.0] Weight for covariance (Any numeric
                                  value)
   -nspenalty          float      [1.0] Non-compatible sequence penalty (Any
                                  numeric value)
   -endgaps            boolean    [N] Mark end gaps
   -most               boolean    [N] Use most informative sequence algorithm
   -ribosumscore       boolean    [N] Use ribosum scoring matrix
   -old                boolean    [N] Use old energy evaluation (gaps as
                                  chars)
   -ssoutfile          outfile    [*.vrnaalifold] Vienna RNA structure
                                  postscript output file
   -alignoutfile       outfile    [*.vrnaalifold] Vienna RNA alignment
                                  postscript output file

   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin1            integer    Start of each sequence to be used
   -send1              integer    End of each sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -scircular1         boolean    Sequence is circular
   -squick1            boolean    Read id and sequence only
   -sformat1           string     Input sequence format
   -iquery1            string     Input query fields or ID list
   -ioffset1           integer    Input start position offset
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name

   "-outfile" associated qualifiers
   -odirectory2        string     Output directory

   "-ssoutfile" associated qualifiers
   -odirectory         string     Output directory

   "-alignoutfile" associated qualifiers
   -odirectory         string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write first file to standard output
   -filter             boolean    Read first file from standard input, write
                                  first file to standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options and exit. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages
   -version            boolean    Report version number and exit

Qualifier Type Description Allowed values Default
Standard (Mandatory) qualifiers
[-sequence]
(Parameter 1)		 seqset (Aligned) nucleotide sequence set filename and optional format, or reference (input USA) Readable set of sequences Required
[-outfile]
(Parameter 2)		 outfile Vienna RNAfold output file Output file <*>.vrnaalifold
Additional (Optional) qualifiers
(none)
Advanced (Unprompted) qualifiers
-constraintfile infile Vienna RNA structure constraints file (optional) Input file Required
-paramfile infile Vienna RNA parameters file (optional) Input file Required
-rsumfile infile Vienna RNA Ribosum file (optional) Input file Required
-temperature float Temperature Any numeric value 37.0
-[no]gu boolean Allow GU pairs Boolean value Yes/No Yes
-[no]closegu boolean Allow GU pairs at end of helices Boolean value Yes/No Yes
-[no]lp boolean Allow lonely pairs Boolean value Yes/No Yes
-[no]convert boolean Convert T to U Boolean value Yes/No Yes
-nsbases string Non-standard bases Any string  
-[no]tetraloop boolean Stabilizing energies for tetra-loops Boolean value Yes/No Yes
-circular boolean Circular RNA Boolean value Yes/No No
-colour boolean Colour structure plot Boolean value Yes/No No
-[no]alnps boolean Produce alignment postscript Boolean value Yes/No Yes
-energy list Rarely used option to fold sequences from the ABCD... alphabet
0 (BP)
1 (Any with GC)
2 (Any with AU parameters)
 0
-scale float Estimate of ensemble free energy Any numeric value 1.07
-dangles list Method
0 (Ignore)
1 (Only unpaired bases for just one dangling end)
2 (Always use dangling energies)
3 (Allow coaxial stacking of adjacent helices)
 2
-covariance float Weight for covariance Any numeric value 1.0
-nspenalty float Non-compatible sequence penalty Any numeric value 1.0
-endgaps boolean Mark end gaps Boolean value Yes/No No
-most boolean Use most informative sequence algorithm Boolean value Yes/No No
-ribosumscore boolean Use ribosum scoring matrix Boolean value Yes/No No
-old boolean Use old energy evaluation (gaps as chars) Boolean value Yes/No No
-ssoutfile outfile Vienna RNA structure postscript output file Output file <*>.vrnaalifold
-alignoutfile outfile Vienna RNA alignment postscript output file Output file <*>.vrnaalifold
Associated qualifiers
"-sequence" associated seqset qualifiers
-sbegin1
-sbegin_sequence		 integer Start of each sequence to be used Any integer value 0
-send1
-send_sequence		 integer End of each sequence to be used Any integer value 0
-sreverse1
-sreverse_sequence		 boolean Reverse (if DNA) Boolean value Yes/No N
-sask1
-sask_sequence		 boolean Ask for begin/end/reverse Boolean value Yes/No N
-snucleotide1
-snucleotide_sequence		 boolean Sequence is nucleotide Boolean value Yes/No N
-sprotein1
-sprotein_sequence		 boolean Sequence is protein Boolean value Yes/No N
-slower1
-slower_sequence		 boolean Make lower case Boolean value Yes/No N
-supper1
-supper_sequence		 boolean Make upper case Boolean value Yes/No N
-scircular1
-scircular_sequence		 boolean Sequence is circular Boolean value Yes/No N
-squick1
-squick_sequence		 boolean Read id and sequence only Boolean value Yes/No N
-sformat1
-sformat_sequence		 string Input sequence format Any string  
-iquery1
-iquery_sequence		 string Input query fields or ID list Any string  
-ioffset1
-ioffset_sequence		 integer Input start position offset Any integer value 0
-sdbname1
-sdbname_sequence		 string Database name Any string  
-sid1
-sid_sequence		 string Entryname Any string  
-ufo1
-ufo_sequence		 string UFO features Any string  
-fformat1
-fformat_sequence		 string Features format Any string  
-fopenfile1
-fopenfile_sequence		 string Features file name Any string  
"-outfile" associated outfile qualifiers
-odirectory2
-odirectory_outfile		 string Output directory Any string  
"-ssoutfile" associated outfile qualifiers
-odirectory string Output directory Any string  
"-alignoutfile" associated outfile qualifiers
-odirectory string Output directory Any string  
General qualifiers
-auto boolean Turn off prompts Boolean value Yes/No N
-stdout boolean Write first file to standard output Boolean value Yes/No N
-filter boolean Read first file from standard input, write first file to standard output Boolean value Yes/No N
-options boolean Prompt for standard and additional values Boolean value Yes/No N
-debug boolean Write debug output to program.dbg Boolean value Yes/No N
-verbose boolean Report some/full command line options Boolean value Yes/No Y
-help boolean Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose Boolean value Yes/No N
-warning boolean Report warnings Boolean value Yes/No Y
-error boolean Report errors Boolean value Yes/No Y
-fatal boolean Report fatal errors Boolean value Yes/No Y
-die boolean Report dying program messages Boolean value Yes/No Y
-version boolean Report version number and exit Boolean value Yes/No N

Input file format

vrnaalifold reads any normal sequence USAs.

Input files for usage example

File: ecoli6s.fasta

>X01238.1/1-183
AUUUCUCUGAGAUGUUCGCAAGCGGGC.CAGUCCCCUGAGCCGAUAUUUCAUACCACAAG
AAUGUGGCGCUCCGCGGUUGGUGAGCAUGCUCGGUCCGU...............CCGAGA
AGCCUUAAAACUGCGACGACACAUUCACCUUGAACCAA.GGGUUCAAGGGUUACAGCCUG
CGGCGGCA.UC.UCGGAG.AUUC
>AL627277.1/108623-108805
AUUUCUCUGAGAUGUUUGCAAGCGGGC.CAGUCCCCUGAGCCGAUAUUUCAUACCACAAG
AAUGUGGCGCUCCGCGGUUGGUGAGCAUGCUCGGUUCGU...............CCGAGA
AGCCUUAAAACUGUGACGACACAUUCACCUUGAACCAA.GGGUUCAAGGGUUACAGCCUG
CGGCGGCA.UC.UCGGAG.AUUC
>AJ414145.1/90993-91174
AUUUCUCUGAGGUGUUUGCCAGCGGGC.CAGUCCCCUGAGCCGAUAUUUAAUACCAACAG
AAUGUAGUGCUCCGUAACCGGUGAGCAUGCUCGGUCCG................CCGAGA
AGCCUUAAGGUUGCGACGCUGCGUUCACCUUGAACCAA.GGGUUCAAGGGUUACAGCCUG
CGACGGCA.CC.UCGGAG.AUCC
>U32767.1/6538-6734
.AUUACCUGGAGUGUUCGUCAGUAGGC.UAUGUCCCUGAGCCGAUACUUUAAAUCUUAUA
AAUU.GGUUUCCUAUCGUUGGUGUGUAGGCUUAACCUUUGACUCGUUCAUUGGGCUAAGA
AACCUGAAAACGGUAUCAACUGAUUU.CCUUGAACCGUCGGGUUCAAGGACUACUGCCCG
CAGCGGCACUC.UGGGGU.CUUC
>AE006208.1/8365-8185
.AUUACCUGAGGUGUUUGCCAGUGGGU.UAUGUCCCUGAGCCGAUACUUU.UAUUUUAUG
AAUC.GGUUUCUAAUUGUUGGUGUGCAUGCUUAGCUUGA...............CUAAGA
AGCCUAAAAAUAGUUAUAACUGAUUC.CCUUGAACCGUUGGGUUCAAGGACUGAGACUUG
CAGCGGCA.UC.UCGGGUUCUUC
>Y00334.1/77-254
CGCUCCCUGGUGUGUUGGCCAGUCGGU.GAUGUCCCUGAGCCGAUAACUGCAACAAC..G
GAGGUUGC.CAGUUGGACCGGUGUGCAUGUCCGCACG.................ACGGAA
AGCCUUAAGGUCUAC.UGCAACCGCCACCUUGAACUUUCGGGUUCAAGGGCUA.ACCCGA
CAGCGGCA.CGACCGGGG.AGCU
>AE004317.1/5626-5807
UUUACCCUGGGGUGUUCGUCAGCGGAUUUAUGUCCCUGAGCCGAUAAGCAACAUAAC..A
GGGUUGGUAUUGGGUAGCUAUUGAGCAAGCUCGGCUUGUA..............CCGAGA
AGCCUGCGGUUACCAUUACUGAUCCG.CCUUGAACCUGAUGGUUCAAGGGCUACGAUCCU
CAACGGCA.UC.CCGGGG.UUC.

Output file format

vrnaalifold outputs a graph to the specified graphics device. outputs a report format file. The default format is ...

Output files for usage example

File: ecoli6s.vrnaalifold

AUUUCCCUGAGGUGUUCGCCAGCGGGC_CAUGUCCCUGAGCCGAUAUUUAAUACCACAAGAAUGUGGUGCUCCGUGGUUGGUGAGCAUGCUCGGCCCGU_______________CCGAGAAGCCUUAAAAUUGCGACGACACAUUCACCUUGAACCAA_GGGUUCAAGGGCUACAGCCUGCAGCGGCA_UC_UCGGGG_AUUC
...((((((((((((.(((..((((((................................(((((((......(((((((.....((...(((((....................)))))..)).....)))))))....))))))).(((((((((....)))))))))......)))))).)))))).)).)))))).)... (-65.91 = -57.83 +  -8.08)

Graphics File: ecoli6s.ssps

[vrnaalifold results]

Graphics File: ecoli6s.alirnaps

[vrnaalifold results]

Data files

For details of Vienna RNA file formats, see the original documentation http://www.tbi.univie.ac.at/~ivo/RNA/

Notes

None.

References

None.

Warnings

None.

Diagnostic Error Messages

None.

Exit status

It always exits with status 0.

Known bugs

None.

See also

Program name Description
banana Plot bending and curvature data for B-DNA
btwisted Calculate the twisting in a B-DNA sequence
einverted Find inverted repeats in nucleotide sequences
ovrnaalifold Calculate secondary structures for a set of aligned RNAs
ovrnaalifoldpf Calculate secondary structures for a set of aligned RNAs (partition)
ovrnacofold Calculate secondary structures of RNA dimers
ovrnacofoldconc Calculate secondary structures of RNA dimers (concentrations)
ovrnacofoldpf Calculate secondary structures of RNA dimers (partitioning)
ovrnadistance Calculate distances between RNA secondary structures
ovrnaduplex Predict RNA duplex (hybridization) sites and structure
ovrnaeval Calculate energy of RNA sequences with a given secondary structure
ovrnaevalpair Calculate energy of RNA sequences on given secondary structure
ovrnafold Calculate min. energy RNA structure / pair probabilities (partition)
ovrnafoldpf Calculate min. energy RNA structure / pair probabilities
ovrnaheat Calculate specific heat of RNA melting
ovrnainverse Find RNA sequences with a given secondary structure
ovrnalfold Calculate locally stable secondary structures of RNAs
ovrnaplot Draw RNA secondary structures
ovrnasubopt Calculate suboptimal secondary structure of RNA
sirna Find siRNA duplexes in mRNA
vrna2dfold Calculate RNA structures and samples of k,l neighbourhoods
vrnaaliduplex RNA duplex calculation for two sequence alignments
vrnaalifoldpf Calculate secondary structures for a set of aligned RNAs (partition)
vrnacofold Calculate secondary structures of RNA dimers
vrnacofoldconc Calculate secondary structures of RNA dimers (concentrations)
vrnacofoldpf Calculate secondary structures of RNA dimers (partitioning)
vrnadistance Calculate distances between RNA secondary structures
vrnaduplex Predict RNA duplex (hybridization) sites and structure
vrnaeval Calculate energy of RNA sequences with a given secondary structure
vrnaevalpair Calculate energy of RNA sequences on given secondary structure
vrnafold Calculate min. energy RNA secondary structures and pair probabilities
vrnafoldpf Calculate min. energy RNA structures / pair probabilities (partition)
vrnaheat Calculate specific heat of RNA melting
vrnainverse Find RNA sequences with a given secondary structure
vrnalalifoldpf Calculate secondary structures for a set of aligned RNAs (partition)
vrnalfold Calculate locally stable secondary structures of RNAs
vrnalfoldz Calculate locally stable secondary structures of RNAs plus zscore
vrnapkplex Calculate RNA structures plus pseudoknots
vrnaplfold Compute avg. pair probabilities for local base pairs in RNA sequences
vrnaplot Draw RNA secondary structures
vrnasubopt Calculate suboptimal secondary structures of RNAs

Author(s)

This program is an EMBOSS conversion of a program written by Ivo Hofacker as part of his VIENNA package.

Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author.

History

Converted (October 2005) by Alan Bleasby

Target users

This program is intended to be used by everyone and everything, from naive users to embedded scripts.

Comments