vrnaalifoldpf

 

Wiki

The master copies of EMBOSS documentation are available at http://emboss.open-bio.org/wiki/Appdocs on the EMBOSS Wiki.

Please help by correcting and extending the Wiki pages.

Function

Calculate secondary structures for a set of aligned RNAs (partition)

Description

This is a port of the Vienna RNA package program RNAalifold.

It reads aligned RNA sequences and calculates their minimum free energy (mfe) structure, partition function (pf) and base pairing probability matrix. It returns the mfe structure in bracket notation, its energy, the free energy of the thermodynamic ensemble and the frequency of the mfe structure in the ensemble. It also produces plots of the resulting secondary structure graph and a "dot plot" of the base pairing matrix.

The original program produces different outputs, depending on the options selected. In the EMBASSY implementation it is split into vrnaalifold and vrnaalifoldpf

Algorithm

See the original documentation for the Vienna RNA package http://www.tbi.univie.ac.at/~ivo/RNA/

Usage

Here is a sample session with vrnaalifoldpf


% vrnaalifoldpf 
Calculate secondary structures for a set of aligned RNAs (partition)
Input (aligned) nucleotide sequence set: ecoli6s.fasta
Vienna RNAfold output file [ecoli6s.vrnaalifoldpf]: 

Go to the input files for this example
Go to the output files for this example

Command line arguments

Calculate secondary structures for a set of aligned RNAs (partition)
Version: EMBOSS:6.6.0.0

   Standard (Mandatory) qualifiers:
  [-sequence]          seqset     (Aligned) nucleotide sequence set filename
                                  and optional format, or reference (input
                                  USA)
  [-outfile]           outfile    [*.vrnaalifoldpf] Vienna RNAfold output file

   Additional (Optional) qualifiers: (none)
   Advanced (Unprompted) qualifiers:
   -constraintfile     infile     Vienna RNA structure constraints file
                                  (optional)
   -paramfile          infile     Vienna RNA parameters file (optional)
   -rsumfile           infile     Vienna RNA Ribosum file (optional)
   -temperature        float      [37.0] Temperature (Any numeric value)
   -[no]gu             boolean    [Y] Allow GU pairs
   -[no]closegu        boolean    [Y] Allow GU pairs at end of helices
   -[no]lp             boolean    [Y] Allow lonely pairs
   -[no]convert        boolean    [Y] Convert T to U
   -nsbases            string     Non-standard bases (Any string)
   -[no]tetraloop      boolean    [Y] Stabilizing energies for tetra-loops
   -circular           boolean    [N] Circular RNA
   -colour             boolean    [N] Colour structure plot
   -[no]alnps          boolean    [Y] Produce alignment postscript
   -mea                boolean    [N] Calculate MEA sructure
   -gammamea           float      [1.0] Gamma value for MEA (Any numeric
                                  value)
   -nback              integer    [0] Number of stochastic backtraces to
                                  display (Any integer value)
   -showenergy         boolean    [N] Show energy probabilities of stochastic
                                  backtraces
   -energy             menu       [0] Rarely used option to fold sequences
                                  from the ABCD... alphabet (Values: 0 (BP); 1
                                  (Any with GC); 2 (Any with AU parameters))
   -scale              float      [1.07] Estimate of ensemble free energy (Any
                                  numeric value)
   -dangles            menu       [2] Method (Values: 0 (Ignore); 1 (Only
                                  unpaired bases for just one dangling end); 2
                                  (Always use dangling energies); 3 (Allow
                                  coaxial stacking of adjacent helices))
   -covariance         float      [1.0] Weight for covariance (Any numeric
                                  value)
   -nspenalty          float      [1.0] Non-compatible sequence penalty (Any
                                  numeric value)
   -endgaps            boolean    [N] Mark end gaps
   -most               boolean    [N] Use most informative sequence algorithm
   -ribosumscore       boolean    [N] Use ribosum scoring matrix
   -old                boolean    [N] Use old energy evaluation (gaps as
                                  chars)
   -ssoutfile          outfile    [*.vrnaalifoldpf] Vienna RNA structure
                                  postscript output file
   -dotoutfile         outfile    [*.vrnaalifoldpf] Vienna dotplot postscript
                                  output file (optional)
   -alignoutfile       outfile    [*.vrnaalifoldpf] Vienna RNA alignment
                                  postscript output file

   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin1            integer    Start of each sequence to be used
   -send1              integer    End of each sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -scircular1         boolean    Sequence is circular
   -squick1            boolean    Read id and sequence only
   -sformat1           string     Input sequence format
   -iquery1            string     Input query fields or ID list
   -ioffset1           integer    Input start position offset
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name

   "-outfile" associated qualifiers
   -odirectory2        string     Output directory

   "-ssoutfile" associated qualifiers
   -odirectory         string     Output directory

   "-dotoutfile" associated qualifiers
   -odirectory         string     Output directory

   "-alignoutfile" associated qualifiers
   -odirectory         string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write first file to standard output
   -filter             boolean    Read first file from standard input, write
                                  first file to standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options and exit. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages
   -version            boolean    Report version number and exit

Qualifier Type Description Allowed values Default
Standard (Mandatory) qualifiers
[-sequence]
(Parameter 1)
seqset (Aligned) nucleotide sequence set filename and optional format, or reference (input USA) Readable set of sequences Required
[-outfile]
(Parameter 2)
outfile Vienna RNAfold output file Output file <*>.vrnaalifoldpf
Additional (Optional) qualifiers
(none)
Advanced (Unprompted) qualifiers
-constraintfile infile Vienna RNA structure constraints file (optional) Input file Required
-paramfile infile Vienna RNA parameters file (optional) Input file Required
-rsumfile infile Vienna RNA Ribosum file (optional) Input file Required
-temperature float Temperature Any numeric value 37.0
-[no]gu boolean Allow GU pairs Boolean value Yes/No Yes
-[no]closegu boolean Allow GU pairs at end of helices Boolean value Yes/No Yes
-[no]lp boolean Allow lonely pairs Boolean value Yes/No Yes
-[no]convert boolean Convert T to U Boolean value Yes/No Yes
-nsbases string Non-standard bases Any string  
-[no]tetraloop boolean Stabilizing energies for tetra-loops Boolean value Yes/No Yes
-circular boolean Circular RNA Boolean value Yes/No No
-colour boolean Colour structure plot Boolean value Yes/No No
-[no]alnps boolean Produce alignment postscript Boolean value Yes/No Yes
-mea boolean Calculate MEA sructure Boolean value Yes/No No
-gammamea float Gamma value for MEA Any numeric value 1.0
-nback integer Number of stochastic backtraces to display Any integer value 0
-showenergy boolean Show energy probabilities of stochastic backtraces Boolean value Yes/No No
-energy list Rarely used option to fold sequences from the ABCD... alphabet
0 (BP)
1 (Any with GC)
2 (Any with AU parameters)
0
-scale float Estimate of ensemble free energy Any numeric value 1.07
-dangles list Method
0 (Ignore)
1 (Only unpaired bases for just one dangling end)
2 (Always use dangling energies)
3 (Allow coaxial stacking of adjacent helices)
2
-covariance float Weight for covariance Any numeric value 1.0
-nspenalty float Non-compatible sequence penalty Any numeric value 1.0
-endgaps boolean Mark end gaps Boolean value Yes/No No
-most boolean Use most informative sequence algorithm Boolean value Yes/No No
-ribosumscore boolean Use ribosum scoring matrix Boolean value Yes/No No
-old boolean Use old energy evaluation (gaps as chars) Boolean value Yes/No No
-ssoutfile outfile Vienna RNA structure postscript output file Output file <*>.vrnaalifoldpf
-dotoutfile outfile Vienna dotplot postscript output file (optional) Output file <*>.vrnaalifoldpf
-alignoutfile outfile Vienna RNA alignment postscript output file Output file <*>.vrnaalifoldpf
Associated qualifiers
"-sequence" associated seqset qualifiers
-sbegin1
-sbegin_sequence
integer Start of each sequence to be used Any integer value 0
-send1
-send_sequence
integer End of each sequence to be used Any integer value 0
-sreverse1
-sreverse_sequence
boolean Reverse (if DNA) Boolean value Yes/No N
-sask1
-sask_sequence
boolean Ask for begin/end/reverse Boolean value Yes/No N
-snucleotide1
-snucleotide_sequence
boolean Sequence is nucleotide Boolean value Yes/No N
-sprotein1
-sprotein_sequence
boolean Sequence is protein Boolean value Yes/No N
-slower1
-slower_sequence
boolean Make lower case Boolean value Yes/No N
-supper1
-supper_sequence
boolean Make upper case Boolean value Yes/No N
-scircular1
-scircular_sequence
boolean Sequence is circular Boolean value Yes/No N
-squick1
-squick_sequence
boolean Read id and sequence only Boolean value Yes/No N
-sformat1
-sformat_sequence
string Input sequence format Any string  
-iquery1
-iquery_sequence
string Input query fields or ID list Any string  
-ioffset1
-ioffset_sequence
integer Input start position offset Any integer value 0
-sdbname1
-sdbname_sequence
string Database name Any string  
-sid1
-sid_sequence
string Entryname Any string  
-ufo1
-ufo_sequence
string UFO features Any string  
-fformat1
-fformat_sequence
string Features format Any string  
-fopenfile1
-fopenfile_sequence
string Features file name Any string  
"-outfile" associated outfile qualifiers
-odirectory2
-odirectory_outfile
string Output directory Any string  
"-ssoutfile" associated outfile qualifiers
-odirectory string Output directory Any string  
"-dotoutfile" associated outfile qualifiers
-odirectory string Output directory Any string  
"-alignoutfile" associated outfile qualifiers
-odirectory string Output directory Any string  
General qualifiers
-auto boolean Turn off prompts Boolean value Yes/No N
-stdout boolean Write first file to standard output Boolean value Yes/No N
-filter boolean Read first file from standard input, write first file to standard output Boolean value Yes/No N
-options boolean Prompt for standard and additional values Boolean value Yes/No N
-debug boolean Write debug output to program.dbg Boolean value Yes/No N
-verbose boolean Report some/full command line options Boolean value Yes/No Y
-help boolean Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose Boolean value Yes/No N
-warning boolean Report warnings Boolean value Yes/No Y
-error boolean Report errors Boolean value Yes/No Y
-fatal boolean Report fatal errors Boolean value Yes/No Y
-die boolean Report dying program messages Boolean value Yes/No Y
-version boolean Report version number and exit Boolean value Yes/No N

Input file format

vrnaalifoldpf reads any normal sequence USAs.

Input files for usage example

File: ecoli6s.fasta

>X01238.1/1-183
AUUUCUCUGAGAUGUUCGCAAGCGGGC.CAGUCCCCUGAGCCGAUAUUUCAUACCACAAG
AAUGUGGCGCUCCGCGGUUGGUGAGCAUGCUCGGUCCGU...............CCGAGA
AGCCUUAAAACUGCGACGACACAUUCACCUUGAACCAA.GGGUUCAAGGGUUACAGCCUG
CGGCGGCA.UC.UCGGAG.AUUC
>AL627277.1/108623-108805
AUUUCUCUGAGAUGUUUGCAAGCGGGC.CAGUCCCCUGAGCCGAUAUUUCAUACCACAAG
AAUGUGGCGCUCCGCGGUUGGUGAGCAUGCUCGGUUCGU...............CCGAGA
AGCCUUAAAACUGUGACGACACAUUCACCUUGAACCAA.GGGUUCAAGGGUUACAGCCUG
CGGCGGCA.UC.UCGGAG.AUUC
>AJ414145.1/90993-91174
AUUUCUCUGAGGUGUUUGCCAGCGGGC.CAGUCCCCUGAGCCGAUAUUUAAUACCAACAG
AAUGUAGUGCUCCGUAACCGGUGAGCAUGCUCGGUCCG................CCGAGA
AGCCUUAAGGUUGCGACGCUGCGUUCACCUUGAACCAA.GGGUUCAAGGGUUACAGCCUG
CGACGGCA.CC.UCGGAG.AUCC
>U32767.1/6538-6734
.AUUACCUGGAGUGUUCGUCAGUAGGC.UAUGUCCCUGAGCCGAUACUUUAAAUCUUAUA
AAUU.GGUUUCCUAUCGUUGGUGUGUAGGCUUAACCUUUGACUCGUUCAUUGGGCUAAGA
AACCUGAAAACGGUAUCAACUGAUUU.CCUUGAACCGUCGGGUUCAAGGACUACUGCCCG
CAGCGGCACUC.UGGGGU.CUUC
>AE006208.1/8365-8185
.AUUACCUGAGGUGUUUGCCAGUGGGU.UAUGUCCCUGAGCCGAUACUUU.UAUUUUAUG
AAUC.GGUUUCUAAUUGUUGGUGUGCAUGCUUAGCUUGA...............CUAAGA
AGCCUAAAAAUAGUUAUAACUGAUUC.CCUUGAACCGUUGGGUUCAAGGACUGAGACUUG
CAGCGGCA.UC.UCGGGUUCUUC
>Y00334.1/77-254
CGCUCCCUGGUGUGUUGGCCAGUCGGU.GAUGUCCCUGAGCCGAUAACUGCAACAAC..G
GAGGUUGC.CAGUUGGACCGGUGUGCAUGUCCGCACG.................ACGGAA
AGCCUUAAGGUCUAC.UGCAACCGCCACCUUGAACUUUCGGGUUCAAGGGCUA.ACCCGA
CAGCGGCA.CGACCGGGG.AGCU
>AE004317.1/5626-5807
UUUACCCUGGGGUGUUCGUCAGCGGAUUUAUGUCCCUGAGCCGAUAAGCAACAUAAC..A
GGGUUGGUAUUGGGUAGCUAUUGAGCAAGCUCGGCUUGUA..............CCGAGA
AGCCUGCGGUUACCAUUACUGAUCCG.CCUUGAACCUGAUGGUUCAAGGGCUACGAUCCU
CAACGGCA.UC.CCGGGG.UUC.

Output file format

vrnaalifoldpf outputs a graph to the specified graphics device. outputs a report format file. The default format is ...

Output files for usage example

Graphics File: ecoli6s.ssps

[vrnaalifoldpf results]

Graphics File: ecoli6s.ps

[vrnaalifoldpf results]

Graphics File: ecoli6s.alirnaps

[vrnaalifoldpf results]

File: ecoli6s.vrnaalifoldpf

AUUUCCCUGAGGUGUUCGCCAGCGGGC_CAUGUCCCUGAGCCGAUAUUUAAUACCACAAGAAUGUGGUGCUCCGUGGUUGGUGAGCAUGCUCGGCCCGU_______________CCGAGAAGCCUUAAAAUUGCGACGACACAUUCACCUUGAACCAA_GGGUUCAAGGGCUACAGCCUGCAGCGGCA_UC_UCGGGG_AUUC
...((((((((((((.(((..((((((................................(((((((......(((((((.....((...(((((....................)))))..)).....)))))))....))))))).(((((((((....)))))))))......)))))).)))))).)).)))))).)... (-65.91 = -57.83 +  -8.08) 
...((((((((((({{(((..((((((................................(((((((......(((((((...,.((...(((((....................)))))..)),....)))))))..,.))))))).(((((((((....)))))))))......)))))).)))))).)).)))))).)... [-68.19]
 frequency of mfe structure in ensemble 0.0247624
...((((((((((((.(((..((((((................................(((((((......(((((((.....((...(((((....................)))))..)).....)))))))....))))))).(((((((((....)))))))))......)))))).)))))).)).)))))).)... -65.91 {-57.83 +  -8.08}
7 sequences; length of alignment 203
alifold output
   64   142  0 100.0%   0.000 CG:1    GC:4    UG:1    UA:1   
   63   143  0 100.0%   0.001 GC:1    GU:1    UG:1    UA:4   
   74   134  0  99.9%   0.002 GC:3    GU:1    AU:2    UA:1   
   10   193  0 100.0%   0.001 GC:2    GU:1    AU:4   
   77   131  0 100.0%   0.001 GC:3    GU:2    AU:2   
   12   190  0 100.0%   0.001 GC:2    GU:3    AU:2   
   66   140  0  98.6%   0.043 GC:4    GU:1    AU:1    UA:1   
   76   132  1  99.9%   0.003 CG:1    GC:1    GU:2    AU:1    UA:1   
    6   197  0 100.0%   0.000 CG:4    UA:3   
   92   117  0 100.0%   0.000 CG:5    UA:2   
   25   178  0 100.0%   0.003 GC:6    GU:1   
   26   177  0 100.0%   0.003 GC:6    AU:1   
   91   118  0 100.0%   0.001 CG:1    UA:6   
   93   116  0 100.0%   0.001 GC:5    AU:2   
   79   129  0  98.8%   0.067 CG:2    UG:1    UA:4   
   61   145  0  99.8%   0.008 GC:2    AU:5   
    5   198  0  99.7%   0.008 CG:5    AU:2   
   65   141  0  99.6%   0.011 UG:2    UA:3    --:2   
   75   133  1  99.9%   0.002 CG:2    GU:1    UG:3   
   23   180  1  99.9%   0.003 CG:3    UG:2    UA:1   
   24   179  1  99.9%   0.006 CG:1    GC:1    GU:4   
   90   119  0  99.1%   0.026 CG:6    UA:1   
    7   196  0 100.0%   0.000 CG:7   
   11   191  1 100.0%   0.001 GC:5    UG:1   
   14   187  0  99.9%   0.002 GC:7   
   13   188  0  99.9%   0.003 UA:7   
   62   144  1  99.9%   0.005 GC:1    AU:5   
    8   195  0  99.8%   0.006 UG:7   
   22   181  0  99.7%   0.010 GC:7   
   78   130  1  99.6%   0.027 CG:2    UA:4   
    9   194  1  99.9%   0.002 GC:6   
   18   184  0  99.4%   0.019 GC:7   
   19   183  1  98.6%   0.050 CG:4    UG:1    UA:1   
   27   176  1  98.2%   0.057 CG:4    UA:2   
  156   161  0  95.7%   0.267 CG:6    UG:1   
   60   146  1  96.2%   0.116 GC:5    AU:1   
  152   165  0  96.2%   0.327 GC:7   
  155   162  0  96.2%   0.244 CG:7   
  153   164  0  96.1%   0.251 AU:7   
  154   163  0  96.1%   0.253 AU:7   
   94   115  2  96.7%   0.097 GC:5   
  151   166  0  96.0%   0.301 UA:7   
  150   167  0  95.2%   0.209 UA:7   


  [Part of this file has been deleted for brevity]

   34    40  0   1.1%   0.204 CG:7    +
   53   151  0   1.1%   0.179 AU:7    +
   35    40  0   1.0%   0.228 CG:7    +
  146   170  2   1.3%   0.736 CG:4    UA:1    +
   40    47  2   1.3%   0.335 GC:2    GU:3    +
   38    42  0   0.9%   0.260 GC:7    +
   85   124  0   0.7%   0.564 GC:7    +
   37    43  0   0.7%   0.372 UG:7    +
   48   157  1   0.1%   0.206 GU:1    UG:2    UA:3    +
   52   152  2   1.0%   0.147 CG:1    UG:4    +
   47   160  1   0.1%   0.134 CG:2    UG:3    AU:1    +
   37    44  0   0.5%   0.211 UA:7    +
   35    43  0   0.5%   0.193 CG:7    +
   39    45  0   0.4%   0.076 AU:7    +
   36    40  0   0.3%   0.186 CG:7    +
   37    46  0   0.3%   0.204 UA:7    +
   34    38  0   0.3%   0.161 CG:7    +
   38    45  0   0.2%   0.216 GU:7    +
   40    48  1   0.2%   0.325 GC:1    GU:5    +
   30   172  0   0.2%   0.130 AU:7    +
   43    48  1   0.1%   0.334 GC:1    GU:5    +
   84   126  2   0.1%   0.095 UG:1    AU:3    UA:1    +
   67   140  1   0.1%   0.046 GC:4    GU:2    +
   53   150  0   0.1%   0.044 AU:7    +
   45    53  0   0.1%   0.069 UA:7    +
   36   169  0   0.1%   0.439 CG:7    +
   79   128  2   0.3%   0.048 UG:1    UA:4    +
   80   124  1   0.4%   0.067 GC:6    +
   55   152  2   0.2%   0.126 CG:4    UG:1    +
   81   123  1   0.4%   0.066 GC:6    +
   82   127  1   0.4%   0.083 UA:6    +
   44    49  1   0.3%   0.205 AU:6    +
   38    55  2   0.1%   0.293 GC:4    GU:1    +
   19   182  2   0.1%   0.026 CG:3    UA:2    +
   70   135  2   0.1%   0.024 CG:3    UA:2    +
  171   175  2   0.1%   0.384 CG:2    UA:3    +
   43    55  2   0.1%   0.290 GC:4    GU:1    +
   31    47  2   0.1%   0.021 GU:3    UA:2    +
  151   157  2   0.1%   0.146 UG:2    UA:3    +
   81   124  1   0.2%   0.082 GC:6    +
   49   153  1   0.2%   0.167 UA:6    +
   39    49  1   0.1%   0.188 AU:6    +
   81   125  1   0.1%   0.070 GU:6    +
   35   170  2   0.3%   0.604 CG:5    +
   49   154  1   0.1%   0.171 UA:6    +
   56   151  2   0.2%   0.109 AU:5    +
   44    48  2   0.2%   0.168 AU:5    +
   48   154  2   0.1%   0.149 UA:5    +
  148   170  2   0.1%   0.713 CG:5    +
   37    56  2   0.1%   0.198 UA:5    +
...((((((((((((.(((..((((((................................(((((((......(((((((.....((...(((((....................)))))..)).....)))))))....))))))).(((((((((....)))))))))......)))))).)))))).)).)))))).)...

Data files

For details of Vienna RNA file formats, see the original documentation http://www.tbi.univie.ac.at/~ivo/RNA/

Notes

None.

References

None.

Warnings

None.

Diagnostic Error Messages

None.

Exit status

It always exits with status 0.

Known bugs

None.

See also

Program name Description
banana Plot bending and curvature data for B-DNA
btwisted Calculate the twisting in a B-DNA sequence
einverted Find inverted repeats in nucleotide sequences
ovrnaalifold Calculate secondary structures for a set of aligned RNAs
ovrnaalifoldpf Calculate secondary structures for a set of aligned RNAs (partition)
ovrnacofold Calculate secondary structures of RNA dimers
ovrnacofoldconc Calculate secondary structures of RNA dimers (concentrations)
ovrnacofoldpf Calculate secondary structures of RNA dimers (partitioning)
ovrnadistance Calculate distances between RNA secondary structures
ovrnaduplex Predict RNA duplex (hybridization) sites and structure
ovrnaeval Calculate energy of RNA sequences with a given secondary structure
ovrnaevalpair Calculate energy of RNA sequences on given secondary structure
ovrnafold Calculate min. energy RNA structure / pair probabilities (partition)
ovrnafoldpf Calculate min. energy RNA structure / pair probabilities
ovrnaheat Calculate specific heat of RNA melting
ovrnainverse Find RNA sequences with a given secondary structure
ovrnalfold Calculate locally stable secondary structures of RNAs
ovrnaplot Draw RNA secondary structures
ovrnasubopt Calculate suboptimal secondary structure of RNA
sirna Find siRNA duplexes in mRNA
vrna2dfold Calculate RNA structures and samples of k,l neighbourhoods
vrnaaliduplex RNA duplex calculation for two sequence alignments
vrnaalifold Calculate secondary structures for a set of aligned RNAs
vrnacofold Calculate secondary structures of RNA dimers
vrnacofoldconc Calculate secondary structures of RNA dimers (concentrations)
vrnacofoldpf Calculate secondary structures of RNA dimers (partitioning)
vrnadistance Calculate distances between RNA secondary structures
vrnaduplex Predict RNA duplex (hybridization) sites and structure
vrnaeval Calculate energy of RNA sequences with a given secondary structure
vrnaevalpair Calculate energy of RNA sequences on given secondary structure
vrnafold Calculate min. energy RNA secondary structures and pair probabilities
vrnafoldpf Calculate min. energy RNA structures / pair probabilities (partition)
vrnaheat Calculate specific heat of RNA melting
vrnainverse Find RNA sequences with a given secondary structure
vrnalalifoldpf Calculate secondary structures for a set of aligned RNAs (partition)
vrnalfold Calculate locally stable secondary structures of RNAs
vrnalfoldz Calculate locally stable secondary structures of RNAs plus zscore
vrnapkplex Calculate RNA structures plus pseudoknots
vrnaplfold Compute avg. pair probabilities for local base pairs in RNA sequences
vrnaplot Draw RNA secondary structures
vrnasubopt Calculate suboptimal secondary structures of RNAs

Author(s)

This program is an EMBOSS conversion of a program written by Ivo Hofacker as part of his VIENNA package.

Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author.

History

Converted (October 2005) by Alan Bleasby

Target users

This program is intended to be used by everyone and everything, from naive users to embedded scripts.

Comments