|
|
vrnainverse |
Please help by correcting and extending the Wiki pages.
This is a port of the Vienna RNA package program RNAinverse.
It searches for sequences folding into a predefined structure, thereby inverting the folding algorithm. Target structures (in bracket notation) and starting sequences for the search are read.
Characters in the start sequence other than "AUGC" (or the alphabet specified with -a) are treated as wild cards and replaced by a random character. Any lower case characters in the start sequence are kept fixed during the search. If necessary, the sequence will be elongated to the length of the structure. Thus a string of "N"s as well as a blank line specify a random start sequence.
For each search the best sequence found and its Hamming distance to the start sequence are output. If the the search was unsuccessful, a structure distance to the target is appended. Optionally the output format can be modified.
The program will continue to read new structures and sequences until a line consisting of the single character "@" or an end of file condition is encountered.
See the original documentation for the Vienna RNA package http://www.tbi.univie.ac.at/~ivo/RNA/
% vrnainverse -repeats 3 Find RNA sequences with a given secondary structure Vienna RNA structures file: rna3.fold Vienna RNAfold output file [rna3.vrnainverse]: |
Go to the input files for this example
Go to the output files for this example
Find RNA sequences with a given secondary structure
Version: EMBOSS:6.6.0.0
Standard (Mandatory) qualifiers:
[-structuresfile] infile Vienna RNA structures file
[-outfile] outfile [*.vrnainverse] Vienna RNAfold output file
Additional (Optional) qualifiers: (none)
Advanced (Unprompted) qualifiers:
-sequence sequence Nucleotide sequence filename and optional
format, or reference (input USA)
-paramfile infile Vienna RNA parameters file (optional)
-temperature float [37.0] Temperature (Any numeric value)
-[no]gu boolean [Y] Allow GU pairs
-[no]closegu boolean [Y] Allow GU pairs at end of helices
-nsbases string Non-standard bases (Any string)
-[no]tetraloop boolean [Y] Stabilizing energies for tetra-loops
-energy menu [0] Rarely used option to fold sequences
from the ABCD... alphabet (Values: 0 (BP); 1
(Any with GC); 2 (Any with AU parameters))
-dangles menu [1] Method (Values: 0 (Ignore); 1 (Only
unpaired bases for just one dangling end); 2
(Always use dangling energies); 3 (Allow
coaxial stacking of adjacent helices))
-folding menu [m] Method (Values: m (Minimum energy); pv
(Partition function); mp (Both))
-alphabet string [AUGC] Find sequences using only these bases
(Any string)
-final float [0.0] Stopping value (Any numeric value)
-repeats integer [0] Number of times to search for the same
structure (Integer 0 or more)
-showfails boolean [N] Show information for unsuccessful
searches
Associated qualifiers:
"-sequence" associated qualifiers
-sbegin integer Start of the sequence to be used
-send integer End of the sequence to be used
-sreverse boolean Reverse (if DNA)
-sask boolean Ask for begin/end/reverse
-snucleotide boolean Sequence is nucleotide
-sprotein boolean Sequence is protein
-slower boolean Make lower case
-supper boolean Make upper case
-scircular boolean Sequence is circular
-squick boolean Read id and sequence only
-sformat string Input sequence format
-iquery string Input query fields or ID list
-ioffset integer Input start position offset
-sdbname string Database name
-sid string Entryname
-ufo string UFO features
-fformat string Features format
-fopenfile string Features file name
"-outfile" associated qualifiers
-odirectory2 string Output directory
General qualifiers:
-auto boolean Turn off prompts
-stdout boolean Write first file to standard output
-filter boolean Read first file from standard input, write
first file to standard output
-options boolean Prompt for standard and additional values
-debug boolean Write debug output to program.dbg
-verbose boolean Report some/full command line options
-help boolean Report command line options and exit. More
information on associated and general
qualifiers can be found with -help -verbose
-warning boolean Report warnings
-error boolean Report errors
-fatal boolean Report fatal errors
-die boolean Report dying program messages
-version boolean Report version number and exit
|
| Qualifier | Type | Description | Allowed values | Default | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Standard (Mandatory) qualifiers | ||||||||||||
| [-structuresfile] (Parameter 1) |
infile | Vienna RNA structures file | Input file | Required | ||||||||
| [-outfile] (Parameter 2) |
outfile | Vienna RNAfold output file | Output file | <*>.vrnainverse | ||||||||
| Additional (Optional) qualifiers | ||||||||||||
| (none) | ||||||||||||
| Advanced (Unprompted) qualifiers | ||||||||||||
| -sequence | sequence | Nucleotide sequence filename and optional format, or reference (input USA) | Readable sequence | Required | ||||||||
| -paramfile | infile | Vienna RNA parameters file (optional) | Input file | Required | ||||||||
| -temperature | float | Temperature | Any numeric value | 37.0 | ||||||||
| -[no]gu | boolean | Allow GU pairs | Boolean value Yes/No | Yes | ||||||||
| -[no]closegu | boolean | Allow GU pairs at end of helices | Boolean value Yes/No | Yes | ||||||||
| -nsbases | string | Non-standard bases | Any string | |||||||||
| -[no]tetraloop | boolean | Stabilizing energies for tetra-loops | Boolean value Yes/No | Yes | ||||||||
| -energy | list | Rarely used option to fold sequences from the ABCD... alphabet |
|
0 | ||||||||
| -dangles | list | Method |
|
1 | ||||||||
| -folding | list | Method |
|
m | ||||||||
| -alphabet | string | Find sequences using only these bases | Any string | AUGC | ||||||||
| -final | float | Stopping value | Any numeric value | 0.0 | ||||||||
| -repeats | integer | Number of times to search for the same structure | Integer 0 or more | 0 | ||||||||
| -showfails | boolean | Show information for unsuccessful searches | Boolean value Yes/No | No | ||||||||
| Associated qualifiers | ||||||||||||
| "-sequence" associated sequence qualifiers | ||||||||||||
| -sbegin | integer | Start of the sequence to be used | Any integer value | 0 | ||||||||
| -send | integer | End of the sequence to be used | Any integer value | 0 | ||||||||
| -sreverse | boolean | Reverse (if DNA) | Boolean value Yes/No | N | ||||||||
| -sask | boolean | Ask for begin/end/reverse | Boolean value Yes/No | N | ||||||||
| -snucleotide | boolean | Sequence is nucleotide | Boolean value Yes/No | N | ||||||||
| -sprotein | boolean | Sequence is protein | Boolean value Yes/No | N | ||||||||
| -slower | boolean | Make lower case | Boolean value Yes/No | N | ||||||||
| -supper | boolean | Make upper case | Boolean value Yes/No | N | ||||||||
| -scircular | boolean | Sequence is circular | Boolean value Yes/No | N | ||||||||
| -squick | boolean | Read id and sequence only | Boolean value Yes/No | N | ||||||||
| -sformat | string | Input sequence format | Any string | |||||||||
| -iquery | string | Input query fields or ID list | Any string | |||||||||
| -ioffset | integer | Input start position offset | Any integer value | 0 | ||||||||
| -sdbname | string | Database name | Any string | |||||||||
| -sid | string | Entryname | Any string | |||||||||
| -ufo | string | UFO features | Any string | |||||||||
| -fformat | string | Features format | Any string | |||||||||
| -fopenfile | string | Features file name | Any string | |||||||||
| "-outfile" associated outfile qualifiers | ||||||||||||
| -odirectory2 -odirectory_outfile |
string | Output directory | Any string | |||||||||
| General qualifiers | ||||||||||||
| -auto | boolean | Turn off prompts | Boolean value Yes/No | N | ||||||||
| -stdout | boolean | Write first file to standard output | Boolean value Yes/No | N | ||||||||
| -filter | boolean | Read first file from standard input, write first file to standard output | Boolean value Yes/No | N | ||||||||
| -options | boolean | Prompt for standard and additional values | Boolean value Yes/No | N | ||||||||
| -debug | boolean | Write debug output to program.dbg | Boolean value Yes/No | N | ||||||||
| -verbose | boolean | Report some/full command line options | Boolean value Yes/No | Y | ||||||||
| -help | boolean | Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose | Boolean value Yes/No | N | ||||||||
| -warning | boolean | Report warnings | Boolean value Yes/No | Y | ||||||||
| -error | boolean | Report errors | Boolean value Yes/No | Y | ||||||||
| -fatal | boolean | Report fatal errors | Boolean value Yes/No | Y | ||||||||
| -die | boolean | Report dying program messages | Boolean value Yes/No | Y | ||||||||
| -version | boolean | Report version number and exit | Boolean value Yes/No | N | ||||||||
(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))).... |
CGGGUGCGAGGUCCCUUGUAUGAUCCGCCGUUUCAGGUAUGGCUACCUUGUUCCAACAUUGAGCAGCACUCGACCG 36 GCUUCCAAUCGAGAUGAGCUCCUCGCGGUUGCAAUACAUAGCCAAGUCCUAUCGCUACAAGGUAGUGGAAGUCAGA 30 GCGUAUUCUGCCUGAACUUGGAGGUUGCCAAAAGCGUCUUGGCUCCAAUCGGUCGAUGUUACCGAAAUGUGCAUGC 27 |
| Program name | Description |
|---|---|
| banana | Plot bending and curvature data for B-DNA |
| btwisted | Calculate the twisting in a B-DNA sequence |
| einverted | Find inverted repeats in nucleotide sequences |
| ovrnaalifold | Calculate secondary structures for a set of aligned RNAs |
| ovrnaalifoldpf | Calculate secondary structures for a set of aligned RNAs (partition) |
| ovrnacofold | Calculate secondary structures of RNA dimers |
| ovrnacofoldconc | Calculate secondary structures of RNA dimers (concentrations) |
| ovrnacofoldpf | Calculate secondary structures of RNA dimers (partitioning) |
| ovrnadistance | Calculate distances between RNA secondary structures |
| ovrnaduplex | Predict RNA duplex (hybridization) sites and structure |
| ovrnaeval | Calculate energy of RNA sequences with a given secondary structure |
| ovrnaevalpair | Calculate energy of RNA sequences on given secondary structure |
| ovrnafold | Calculate min. energy RNA structure / pair probabilities (partition) |
| ovrnafoldpf | Calculate min. energy RNA structure / pair probabilities |
| ovrnaheat | Calculate specific heat of RNA melting |
| ovrnainverse | Find RNA sequences with a given secondary structure |
| ovrnalfold | Calculate locally stable secondary structures of RNAs |
| ovrnaplot | Draw RNA secondary structures |
| ovrnasubopt | Calculate suboptimal secondary structure of RNA |
| sirna | Find siRNA duplexes in mRNA |
| vrna2dfold | Calculate RNA structures and samples of k,l neighbourhoods |
| vrnaaliduplex | RNA duplex calculation for two sequence alignments |
| vrnaalifold | Calculate secondary structures for a set of aligned RNAs |
| vrnaalifoldpf | Calculate secondary structures for a set of aligned RNAs (partition) |
| vrnacofold | Calculate secondary structures of RNA dimers |
| vrnacofoldconc | Calculate secondary structures of RNA dimers (concentrations) |
| vrnacofoldpf | Calculate secondary structures of RNA dimers (partitioning) |
| vrnadistance | Calculate distances between RNA secondary structures |
| vrnaduplex | Predict RNA duplex (hybridization) sites and structure |
| vrnaeval | Calculate energy of RNA sequences with a given secondary structure |
| vrnaevalpair | Calculate energy of RNA sequences on given secondary structure |
| vrnafold | Calculate min. energy RNA secondary structures and pair probabilities |
| vrnafoldpf | Calculate min. energy RNA structures / pair probabilities (partition) |
| vrnaheat | Calculate specific heat of RNA melting |
| vrnalalifoldpf | Calculate secondary structures for a set of aligned RNAs (partition) |
| vrnalfold | Calculate locally stable secondary structures of RNAs |
| vrnalfoldz | Calculate locally stable secondary structures of RNAs plus zscore |
| vrnapkplex | Calculate RNA structures plus pseudoknots |
| vrnaplfold | Compute avg. pair probabilities for local base pairs in RNA sequences |
| vrnaplot | Draw RNA secondary structures |
| vrnasubopt | Calculate suboptimal secondary structures of RNAs |
Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author.