EMBASSY: VIENNA: vrnaalifold

vrnaalifold

Function

RNA alignment folding

Description

This is a port of the Vienna RNA package program RNAalifold.

The original program produces different outputs, depending on the options selected. In the EMBASSY implementation it is split into vrnaalifold and vrnaalifoldpf

Algorithm

See the original documentation for the Vienna RNA package http://www.tbi.univie.ac.at/~ivo/RNA/

Usage

Here is a sample session with vrnaalifold

% vrnaalifold RNA alignment folding Input (aligned) nucleotide sequence set: ecoli6s.fasta Vienna RNAfold output file [ecoli6s.vrnaalifold]:

Go to the input files for this example
Go to the output files for this example

Command line arguments

   Standard (Mandatory) qualifiers:
  [-sequence]          seqset     (Aligned) nucleotide sequence set filename
                                  and optional format, or reference (input
                                  USA)
  [-outfile]           outfile    [*.vrnaalifold] Vienna RNAfold output file

   Additional (Optional) qualifiers: (none)
   Advanced (Unprompted) qualifiers:
   -constraintfile     infile     Vienna RNA structure constraints file
                                  (optional)
   -paramfile          infile     Vienna RNA parameters file (optional)
   -temperature        float      [37.0] Temperature (Any numeric value)
   -[no]gu             boolean    [Y] Allow GU pairs
   -[no]closegu        boolean    [Y] Allow GU pairs at end of helices
   -[no]lp             boolean    [Y] Allow lonely pairs
   -[no]convert        boolean    [Y] Convert T to U
   -nsbases            string     Non-standard bases (Any string is accepted)
   -[no]tetraloop      boolean    [Y] Stabilizing energies for tetra-loops
   -circular           boolean    [N] Circular RNA
   -colour             boolean    [N] Colour structure plot
   -energy             menu       [0] Rarely used option to fold sequences
                                  from the ABCD... alphabet (Values: 0 (BP); 1
                                  (Any with GC); 2 (Any with AU parameters))
   -scale              float      [1.07] Estimate of ensemble free energy (Any
                                  numeric value)
   -dangles            menu       [2] Method (Values: 0 (Ignore); 1 (Only
                                  unpaired bases for just one dangling end); 2
                                  (Always use dangling energies); 3 (Allow
                                  coaxial stacking of adjacent helices))
   -covariance         float      [1.0] Weight for covariance (Any numeric
                                  value)
   -nspenalty          float      [1.0] Non-compatible sequence penalty (Any
                                  numeric value)
   -endgaps            boolean    [N] Mark end gaps
   -most               boolean    [N] Use most informative sequence algorithm
   -ssoutfile          outfile    [*.vrnaalifold] Vienna structure postscript
                                  output file
   -alignoutfile       outfile    [*.vrnaalifold] Vienna alignment colour
                                  postscript output file

   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin1            integer    Start of each sequence to be used
   -send1              integer    End of each sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -sformat1           string     Input sequence format
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name

   "-outfile" associated qualifiers
   -odirectory2        string     Output directory

   "-ssoutfile" associated qualifiers
   -odirectory         string     Output directory

   "-alignoutfile" associated qualifiers
   -odirectory         string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write first file to standard output
   -filter             boolean    Read first file from standard input, write
                                  first file to standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages

Standard (Mandatory) qualifiers Allowed values Default

[-sequence]
(Parameter 1) (Aligned) nucleotide sequence set filename and optional format, or reference (input USA) Readable set of sequences Required

[-outfile]
(Parameter 2) Vienna RNAfold output file Output file <*>.vrnaalifold

Additional (Optional) qualifiers Allowed values Default

(none)

Advanced (Unprompted) qualifiers Allowed values Default

-constraintfile Vienna RNA structure constraints file (optional) Input file Required

-paramfile Vienna RNA parameters file (optional) Input file Required

-temperature Temperature Any numeric value 37.0

-[no]gu Allow GU pairs Boolean value Yes/No Yes

-[no]closegu Allow GU pairs at end of helices Boolean value Yes/No Yes

-[no]lp Allow lonely pairs Boolean value Yes/No Yes

-[no]convert Convert T to U Boolean value Yes/No Yes

-nsbases Non-standard bases Any string is accepted An empty string is accepted

-[no]tetraloop Stabilizing energies for tetra-loops Boolean value Yes/No Yes

-circular Circular RNA Boolean value Yes/No No

-colour Colour structure plot Boolean value Yes/No No

-energy Rarely used option to fold sequences from the ABCD... alphabet
0 (BP)
1 (Any with GC)
2 (Any with AU parameters)
0

-scale Estimate of ensemble free energy Any numeric value 1.07

-dangles Method
0 (Ignore)
1 (Only unpaired bases for just one dangling end)
2 (Always use dangling energies)
3 (Allow coaxial stacking of adjacent helices)
2

-covariance Weight for covariance Any numeric value 1.0

-nspenalty Non-compatible sequence penalty Any numeric value 1.0

-endgaps Mark end gaps Boolean value Yes/No No

-most Use most informative sequence algorithm Boolean value Yes/No No

-ssoutfile Vienna structure postscript output file Output file <*>.vrnaalifold

-alignoutfile Vienna alignment colour postscript output file Output file <*>.vrnaalifold

Input file format

vrnaalifold reads any normal sequence USAs.

Input files for usage example

File: ecoli6s.fasta

>X01238.1/1-183
AUUUCUCUGAGAUGUUCGCAAGCGGGC.CAGUCCCCUGAGCCGAUAUUUCAUACCACAAG
AAUGUGGCGCUCCGCGGUUGGUGAGCAUGCUCGGUCCGU...............CCGAGA
AGCCUUAAAACUGCGACGACACAUUCACCUUGAACCAA.GGGUUCAAGGGUUACAGCCUG
CGGCGGCA.UC.UCGGAG.AUUC
>AL627277.1/108623-108805
AUUUCUCUGAGAUGUUUGCAAGCGGGC.CAGUCCCCUGAGCCGAUAUUUCAUACCACAAG
AAUGUGGCGCUCCGCGGUUGGUGAGCAUGCUCGGUUCGU...............CCGAGA
AGCCUUAAAACUGUGACGACACAUUCACCUUGAACCAA.GGGUUCAAGGGUUACAGCCUG
CGGCGGCA.UC.UCGGAG.AUUC
>AJ414145.1/90993-91174
AUUUCUCUGAGGUGUUUGCCAGCGGGC.CAGUCCCCUGAGCCGAUAUUUAAUACCAACAG
AAUGUAGUGCUCCGUAACCGGUGAGCAUGCUCGGUCCG................CCGAGA
AGCCUUAAGGUUGCGACGCUGCGUUCACCUUGAACCAA.GGGUUCAAGGGUUACAGCCUG
CGACGGCA.CC.UCGGAG.AUCC
>U32767.1/6538-6734
.AUUACCUGGAGUGUUCGUCAGUAGGC.UAUGUCCCUGAGCCGAUACUUUAAAUCUUAUA
AAUU.GGUUUCCUAUCGUUGGUGUGUAGGCUUAACCUUUGACUCGUUCAUUGGGCUAAGA
AACCUGAAAACGGUAUCAACUGAUUU.CCUUGAACCGUCGGGUUCAAGGACUACUGCCCG
CAGCGGCACUC.UGGGGU.CUUC
>AE006208.1/8365-8185
.AUUACCUGAGGUGUUUGCCAGUGGGU.UAUGUCCCUGAGCCGAUACUUU.UAUUUUAUG
AAUC.GGUUUCUAAUUGUUGGUGUGCAUGCUUAGCUUGA...............CUAAGA
AGCCUAAAAAUAGUUAUAACUGAUUC.CCUUGAACCGUUGGGUUCAAGGACUGAGACUUG
CAGCGGCA.UC.UCGGGUUCUUC
>Y00334.1/77-254
CGCUCCCUGGUGUGUUGGCCAGUCGGU.GAUGUCCCUGAGCCGAUAACUGCAACAAC..G
GAGGUUGC.CAGUUGGACCGGUGUGCAUGUCCGCACG.................ACGGAA
AGCCUUAAGGUCUAC.UGCAACCGCCACCUUGAACUUUCGGGUUCAAGGGCUA.ACCCGA
CAGCGGCA.CGACCGGGG.AGCU
>AE004317.1/5626-5807
UUUACCCUGGGGUGUUCGUCAGCGGAUUUAUGUCCCUGAGCCGAUAAGCAACAUAAC..A
GGGUUGGUAUUGGGUAGCUAUUGAGCAAGCUCGGCUUGUA..............CCGAGA
AGCCUGCGGUUACCAUUACUGAUCCG.CCUUGAACCUGAUGGUUCAAGGGCUACGAUCCU
CAACGGCA.UC.CCGGGG.UUC.

Output file format

vrnaalifold outputs a graph to the specified graphics device. outputs a report format file. The default format is ...

Output files for usage example

File: ecoli6s.vrnaalifold

AUUUCCCUGAGGUGUUCGCCAGCGGGC_CAUGUCCCUGAGCCGAUAUUUAAUACCACAAGAAUGUGGUGCUCCGUGGUUGGUGAGCAUGCUCGGCCCGU_______________CCGAGAAGCCUUAAAAUUGCGACGACACAUUCACCUUGAACCAA_GGGUUCAAGGGCUACAGCCUGCAGCGGCA_UC_UCGGGG_AUUC
....(((((((((((.(((..((((((................................(((((((......(((((((...(.((...(((((....................)))))..)))....)))))))....))))))).(((((((((....)))))))))......)))))).)))))).)).))))))..... (-56.91 = -48.71 +  -8.20)

File: ecoli6s.ssps

%!PS-Adobe-3.0 EPSF-3.0
%%Creator: ePS_dot.c,v 1.6 2008/06/26 08:40:00 rice Exp $, ViennaRNA-1.7.2
%%CreationDate: Sun Jul 15 12:00:00 2007
%%Title: RNA Secondary Structure Plot
%%BoundingBox: 66 210 518 662
%%DocumentFonts: Helvetica
%%Pages: 1
%%EndComments

%Options: -d2 
% to switch off outline pairs of sequence comment or
% delete the appropriate line near the end of the file

%%BeginProlog
/RNAplot 100 dict def
RNAplot begin
/fsize  14 def
/outlinecolor {0.2 setgray} bind def
/paircolor    {0.2 setgray} bind def
/seqcolor     {0   setgray} bind def
/cshow  { dup stringwidth pop -2 div fsize -3 div rmoveto show} bind def
/min { 2 copy gt { exch } if pop } bind def
/max { 2 copy lt { exch } if pop } bind def
/drawoutline {
  gsave outlinecolor newpath
  coor 0 get aload pop 0.8 0 360 arc % draw 5' circle of 1st sequence
  currentdict /cutpoint known        % check if cutpoint is defined
  {coor 0 cutpoint getinterval
   {aload pop lineto} forall         % draw outline of 1st sequence
   coor cutpoint get aload pop
   2 copy moveto 0.8 0 360 arc       % draw 5' circle of 2nd sequence
   coor cutpoint coor length cutpoint sub getinterval
   {aload pop lineto} forall}        % draw outline of 2nd sequence
  {coor {aload pop lineto} forall}   % draw outline as a whole
  ifelse
  stroke grestore
} bind def
/drawpairs {
  paircolor
  0.7 setlinewidth
  [9 3.01] 9 setdash
  newpath
  pairs {aload pop
     coor exch 1 sub get aload pop moveto
     coor exch 1 sub get aload pop lineto
  } forall
  stroke
} bind def
% draw bases
/drawbases {


  [Part of this file has been deleted for brevity]

60 cmark
146 cmark
61 cmark
145 cmark
62 144 1 gmark
62 cmark
144 cmark
63 cmark
143 cmark
64 cmark
142 cmark
65 141 2 gmark
141 cmark
66 cmark
140 cmark
73 135 2 gmark
73 cmark
135 cmark
74 cmark
134 cmark
75 133 1 gmark
75 cmark
133 cmark
76 132 1 gmark
76 cmark
132 cmark
77 cmark
131 cmark
78 130 1 gmark
78 cmark
130 cmark
79 cmark
129 cmark
86 cmark
122 cmark
90 cmark
119 cmark
91 cmark
118 cmark
92 cmark
117 cmark
93 cmark
116 cmark
94 115 2 gmark
156 cmark

% End Annotations
% show it
showpage
end
%%EOF

File: ecoli6s.alirnaps

%!PS-Adobe-3.0 EPSF-3.0
%%BoundingBox: 0 0 576 428
%%EndComments
% draws Vienna RNA like colored boxes
/box { % x1 y1 x2 y2 hue saturation
  gsave
  dup 0.3 mul 1 exch sub sethsbcolor
  exch 3 index sub exch 2 index sub rectfill
  grestore
} def
% draws a box in current color
/box2 { % x1 y1 x2 y2
  exch 3 index sub exch 2 index sub rectfill
} def
/string { % (Text) x y
 6 add
 moveto
  show
} def
0 428 translate
1 -1 scale
/Courier findfont
[10 0 0 -10 0 0] makefont setfont
192.0 11.5 198.0 20.0 0.16 1 box
192.0 20.0 198.0 28.5 0.16 1 box
192.0 28.5 198.0 37.0 0.16 1 box
192.0 37.0 198.0 45.5 0.16 1 box
192.0 45.5 198.0 54.0 0.16 1 box
192.0 54.0 198.0 62.5 0.16 1 box
192.0 62.5 198.0 71.0 0.16 1 box
270.0 331.0 276.0 339.5 0.16 1 box
270.0 339.5 276.0 348.0 0.16 1 box
270.0 348.0 276.0 356.5 0.16 1 box
270.0 356.5 276.0 365.0 0.16 1 box
270.0 365.0 276.0 373.5 0.16 1 box
270.0 373.5 276.0 382.0 0.16 1 box
270.0 382.0 276.0 390.5 0.16 1 box
198.0 11.5 204.0 20.0 0.16 1 box
198.0 20.0 204.0 28.5 0.16 1 box
198.0 28.5 204.0 37.0 0.16 1 box
198.0 37.0 204.0 45.5 0.16 1 box
198.0 45.5 204.0 54.0 0.16 1 box
198.0 54.0 204.0 62.5 0.16 1 box
198.0 62.5 204.0 71.0 0.16 1 box
264.0 331.0 270.0 339.5 0.16 1 box
264.0 339.5 270.0 348.0 0.16 1 box
264.0 348.0 270.0 356.5 0.16 1 box
264.0 356.5 270.0 365.0 0.16 1 box
264.0 365.0 270.0 373.5 0.16 1 box
264.0 373.5 270.0 382.0 0.16 1 box


  [Part of this file has been deleted for brevity]

516.0 306.9 522.0 315.0 box2
522.0 304.2 528.0 315.0 box2
0 setgray
(\).\)\)\)\)\)\).\)\).\)\)\)\)\)\).....) 168.0 321.5 string
(X01238.1/1-183) 6.0 332.0 string
(CGGCGGCA-UC-UCGGAG-AUUC) 168.0 332.0 string
(183) 312.0 332.0 string
(AL627277.1/108623-108805) 6.0 340.5 string
(CGGCGGCA-UC-UCGGAG-AUUC) 168.0 340.5 string
(183) 312.0 340.5 string
(AJ414145.1/90993-91174) 6.0 349.0 string
(CGACGGCA-CC-UCGGAG-AUCC) 168.0 349.0 string
(182) 312.0 349.0 string
(U32767.1/6538-6734) 6.0 357.5 string
(CAGCGGCACUC-UGGGGU-CUUC) 168.0 357.5 string
(197) 312.0 357.5 string
(AE006208.1/8365-8185) 6.0 366.0 string
(CAGCGGCA-UC-UCGGGUUCUUC) 168.0 366.0 string
(181) 312.0 366.0 string
(Y00334.1/77-254) 6.0 374.5 string
(CAGCGGCA-CGACCGGGG-AGCU) 168.0 374.5 string
(178) 312.0 374.5 string
(AE004317.1/5626-5807) 6.0 383.0 string
(CAACGGCA-UC-CCGGGG-UUC-) 168.0 383.0 string
(182) 312.0 383.0 string
(.........190.......200.) 168.0 393.5 string
0.6 setgray
168.0 405.2 174.0 421.5 box2
174.0 413.4 180.0 421.5 box2
180.0 410.7 186.0 421.5 box2
186.0 405.2 192.0 421.5 box2
192.0 405.2 198.0 421.5 box2
198.0 405.2 204.0 421.5 box2
204.0 405.2 210.0 421.5 box2
210.0 405.2 216.0 421.5 box2
216.0 420.5 222.0 421.5 box2
222.0 410.7 228.0 421.5 box2
228.0 408.0 234.0 421.5 box2
234.0 420.5 240.0 421.5 box2
240.0 410.7 246.0 421.5 box2
246.0 408.0 252.0 421.5 box2
252.0 405.2 258.0 421.5 box2
258.0 405.2 264.0 421.5 box2
264.0 413.4 270.0 421.5 box2
270.0 410.7 276.0 421.5 box2
276.0 420.5 282.0 421.5 box2
282.0 413.4 288.0 421.5 box2
288.0 408.0 294.0 421.5 box2
294.0 413.4 300.0 421.5 box2
300.0 410.7 306.0 421.5 box2
showpage

Data files

For details of Vienna RNA file formats, see the original documentation http://www.tbi.univie.ac.at/~ivo/RNA/

Notes

None.

References

None.

Warnings

None.

Diagnostic Error Messages

None.

Exit status

It always exits with status 0.

Known bugs

None.

Program name	Description
einverted	Finds inverted repeats in nucleotide sequences
vrnaalifoldpf	RNA alignment folding with partition
vrnacofold	RNA cofolding
vrnacofoldconc	RNA cofolding with concentrations
vrnacofoldpf	RNA cofolding with partitioning
vrnadistance	RNA distances
vrnaduplex	RNA duplex calculation
vrnaeval	RNA eval
vrnaevalpair	RNA eval with cofold
vrnafold	Calculate secondary structures of RNAs
vrnafoldpf	Secondary structures of RNAs with partition
vrnaheat	RNA melting
vrnainverse	RNA sequences matching a structure
vrnalfold	Calculate locally stable secondary structures of RNAs
vrnaplot	Plot vrnafold output
vrnasubopt	Calculate RNA suboptimals

Author(s)

This program is an EMBOSS conversion of a program written by Ivo Hofacker as part of his VIENNA package.

Although we take every care to ensure that the results of the EMBOSS version are identical to those from the original package, we recommend that you check your inputs give the same results in both versions before publication.

Please report all bugs in the EMBOSS version to the EMBOSS bug team, not to the original author.

History

Converted (October 2005) by Alan Bleasby

Target users

This program is intended to be used by everyone and everything, from naive users to embedded scripts.

Function

Description

Algorithm

Usage

Command line arguments

Input file format

Input files for usage example

File: ecoli6s.fasta

Output file format

Output files for usage example

File: ecoli6s.vrnaalifold

File: ecoli6s.ssps

File: ecoli6s.alirnaps

Data files

Notes

References

Warnings

Diagnostic Error Messages

Exit status

Known bugs

See also

Author(s)

History

Target users

Comments