Standard (Mandatory) qualifiers:
  [-asequence]         sequence   Nucleotide sequence filename and optional
                                  format, or reference (input USA)
  [-bsequence]         sequence   Nucleotide sequence filename and optional
                                  format, or reference (input USA)
  [-outfile]           outfile    [*.vrnacofoldpf] Vienna RNAfold output file

   Additional (Optional) qualifiers: (none)
   Advanced (Unprompted) qualifiers:
   -aconstraintfile    infile     Vienna RNA structure constraints file
                                  (optional)
   -bconstraintfile    infile     Second vienna RNA structure constraints file
                                  (optional)
   -paramfile          infile     Vienna RNA parameters file (optional)
   -temperature        float      [37.0] Temperature (Any numeric value)
   -[no]gu             boolean    [Y] Allow GU pairs
   -[no]closegu        boolean    [Y] Allow GU pairs at end of helices
   -[no]lp             boolean    [Y] Allow lonely pairs
   -[no]convert        boolean    [Y] Convert T to U
   -nsbases            string     Non-standard bases (Any string is accepted)
   -[no]tetraloop      boolean    [Y] Stabilizing energies for tetra-loops
   -energy             menu       [0] Rarely used option to fold sequences
                                  from the ABCD... alphabet (Values: 0 (BP); 1
                                  (Any with GC); 2 (Any with AU parameters))
   -scale              float      [1.07] Estimate of ensemble free energy (Any
                                  numeric value)
   -dangles            menu       [1] Method (Values: 0 (Ignore); 1 (Only
                                  unpaired bases for just one dangling end); 2
                                  (Always use dangling energies); 3 (Allow
                                  coaxial stacking of adjacent helices))
   -paired             boolean    [N] Calculate probabilities of base pairing
   -ssoutfile          outfile    [*.vrnacofoldpf] Vienna structure postscript
                                  output file
   -dotoutfile         outfile    [*.vrnacofoldpf] Vienna dotplot postscript
                                  output file

   Associated qualifiers:

   "-asequence" associated qualifiers
   -sbegin1            integer    Start of the sequence to be used
   -send1              integer    End of the sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -sformat1           string     Input sequence format
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name

   "-bsequence" associated qualifiers
   -sbegin2            integer    Start of the sequence to be used
   -send2              integer    End of the sequence to be used
   -sreverse2          boolean    Reverse (if DNA)
   -sask2              boolean    Ask for begin/end/reverse
   -snucleotide2       boolean    Sequence is nucleotide
   -sprotein2          boolean    Sequence is protein
   -slower2            boolean    Make lower case
   -supper2            boolean    Make upper case
   -sformat2           string     Input sequence format
   -sdbname2           string     Database name
   -sid2               string     Entryname
   -ufo2               string     UFO features
   -fformat2           string     Features format
   -fopenfile2         string     Features file name

   "-outfile" associated qualifiers
   -odirectory3        string     Output directory

   "-ssoutfile" associated qualifiers
   -odirectory         string     Output directory

   "-dotoutfile" associated qualifiers
   -odirectory         string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write first file to standard output
   -filter             boolean    Read first file from standard input, write
                                  first file to standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages

>red
AUGAAGAUGA

>blue
CUGUCUGUCUUGAGACA

AUGAAGAUGA&CUGUCUGUCUUGAGACA
....((((..&..))))(((....))). ( -4.40)
....((((,.&..)))}(((....))). [ -5.88]
 frequency of mfe structure in ensemble 0.279848 , delta G binding= -1.57

%!PS-Adobe-3.0 EPSF-3.0
%%Creator: ePS_dot.c,v 1.6 2008/06/26 08:40:00 rice Exp $, ViennaRNA-1.7.2
%%CreationDate: Sun Jul 15 12:00:00 2007
%%Title: RNA Secondary Structure Plot
%%BoundingBox: 66 210 518 662
%%DocumentFonts: Helvetica
%%Pages: 1
%%EndComments

%Options: 
% to switch off outline pairs of sequence comment or
% delete the appropriate line near the end of the file

%%BeginProlog
/RNAplot 100 dict def
RNAplot begin
/fsize  14 def
/outlinecolor {0.2 setgray} bind def
/paircolor    {0.2 setgray} bind def
/seqcolor     {0   setgray} bind def
/cshow  { dup stringwidth pop -2 div fsize -3 div rmoveto show} bind def
/min { 2 copy gt { exch } if pop } bind def
/max { 2 copy lt { exch } if pop } bind def
/drawoutline {
  gsave outlinecolor newpath
  coor 0 get aload pop 0.8 0 360 arc % draw 5' circle of 1st sequence
  currentdict /cutpoint known        % check if cutpoint is defined
  {coor 0 cutpoint getinterval
   {aload pop lineto} forall         % draw outline of 1st sequence
   coor cutpoint get aload pop
   2 copy moveto 0.8 0 360 arc       % draw 5' circle of 2nd sequence
   coor cutpoint coor length cutpoint sub getinterval
   {aload pop lineto} forall}        % draw outline of 2nd sequence
  {coor {aload pop lineto} forall}   % draw outline as a whole
  ifelse
  stroke grestore
} bind def
/drawpairs {
  paircolor
  0.7 setlinewidth
  [9 3.01] 9 setdash
  newpath
  pairs {aload pop
     coor exch 1 sub get aload pop moveto
     coor exch 1 sub get aload pop lineto
  } forall
  stroke
} bind def
% draw bases
/drawbases {


  [Part of this file has been deleted for brevity]

AUGAAGAUGACUGUCUGUCUUGAGACA\
) def
/coor [
[96.276 111.415]
[91.331 110.049]
[86.992 106.486]
[84.234 101.044]
[83.858 94.465]
[73.252 83.858]
[62.645 73.252]
[52.039 62.645]
[36.067 58.926]
[31.562 43.157]
[43.157 31.562]
[58.926 36.067]
[62.645 52.039]
[73.252 62.645]
[83.858 73.252]
[94.465 83.858]
[107.979 90.367]
[122.885 92.046]
[137.791 93.726]
[152.597 86.675]
[165.951 96.194]
[164.115 112.490]
[148.978 118.799]
[136.111 108.631]
[121.206 106.952]
[106.300 105.272]
[104.357 108.419]
] def
/pairs [
[5 16]
[6 15]
[7 14]
[8 13]
[17 26]
[18 25]
[19 24]
] def

init

% switch off outline pairs or bases by removing these lines
drawoutline
drawpairs
drawbases
% show it
showpage
end
%%EOF