Standard (Mandatory) qualifiers:
  [-asequence]         sequence   Nucleotide sequence filename and optional
                                  format, or reference (input USA)
  [-bsequence]         sequence   Nucleotide sequence filename and optional
                                  format, or reference (input USA)
  [-concentrationfile] infile     Vienna RNA concentration data file
  [-outfile]           outfile    [*.vrnacofoldconc] Vienna RNAfold output
                                  file

   Additional (Optional) qualifiers: (none)
   Advanced (Unprompted) qualifiers:
   -aconstraintfile    infile     Vienna RNA structure constraints file
                                  (optional)
   -bconstraintfile    infile     Second vienna RNA structure constraints file
                                  (optional)
   -paramfile          infile     Vienna RNA parameters file (optional)
   -temperature        float      [37.0] Temperature (Any numeric value)
   -[no]gu             boolean    [Y] Allow GU pairs
   -[no]closegu        boolean    [Y] Allow GU pairs at end of helices
   -[no]lp             boolean    [Y] Allow lonely pairs
   -[no]convert        boolean    [Y] Convert T to U
   -nsbases            string     Non-standard bases (Any string is accepted)
   -[no]tetraloop      boolean    [Y] Stabilizing energies for tetra-loops
   -energy             menu       [0] Rarely used option to fold sequences
                                  from the ABCD... alphabet (Values: 0 (BP); 1
                                  (Any with GC); 2 (Any with AU parameters))
   -scale              float      [1.07] Estimate of ensemble free energy (Any
                                  numeric value)
   -dangles            menu       [1] Method (Values: 0 (Ignore); 1 (Only
                                  unpaired bases for just one dangling end); 2
                                  (Always use dangling energies); 3 (Allow
                                  coaxial stacking of adjacent helices))
   -paired             boolean    [N] Calculate probabilities of base pairing
   -ssoutfile          outfile    [*.vrnacofoldconc] Output file name
   -aoutfile           outfile    [*.vrnacofoldconc] First (a) vienna dotplot
                                  output file
   -aaoutfile          outfile    [*.vrnacofoldconc] Second (a-a) vienna
                                  dotplot output file
   -boutfile           outfile    [*.vrnacofoldconc] Third (b) vienna dotplot
                                  output file
   -bboutfile          outfile    [*.vrnacofoldconc] Fourth (b-b) vienna
                                  dotplot output file
   -aboutfile          outfile    [*.vrnacofoldconc] Fifth (a-b) vienna
                                  dotplot output file

   Associated qualifiers:

   "-asequence" associated qualifiers
   -sbegin1            integer    Start of the sequence to be used
   -send1              integer    End of the sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -sformat1           string     Input sequence format
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name

   "-bsequence" associated qualifiers
   -sbegin2            integer    Start of the sequence to be used
   -send2              integer    End of the sequence to be used
   -sreverse2          boolean    Reverse (if DNA)
   -sask2              boolean    Ask for begin/end/reverse
   -snucleotide2       boolean    Sequence is nucleotide
   -sprotein2          boolean    Sequence is protein
   -slower2            boolean    Make lower case
   -supper2            boolean    Make upper case
   -sformat2           string     Input sequence format
   -sdbname2           string     Database name
   -sid2               string     Entryname
   -ufo2               string     UFO features
   -fformat2           string     Features format
   -fopenfile2         string     Features file name

   "-outfile" associated qualifiers
   -odirectory4        string     Output directory

   "-ssoutfile" associated qualifiers
   -odirectory         string     Output directory

   "-aoutfile" associated qualifiers
   -odirectory         string     Output directory

   "-aaoutfile" associated qualifiers
   -odirectory         string     Output directory

   "-boutfile" associated qualifiers
   -odirectory         string     Output directory

   "-bboutfile" associated qualifiers
   -odirectory         string     Output directory

   "-aboutfile" associated qualifiers
   -odirectory         string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write first file to standard output
   -filter             boolean    Read first file from standard input, write
                                  first file to standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages

>red
AUGAAGAUGA

>blue
CUGUCUGUCUUGAGACA

10 10

AUGAAGAUGA&CUGUCUGUCUUGAGACA
....((((..&..))))(((....))). ( -4.40)
....((((,.&..)))}(((....))). [ -5.88]
 frequency of mfe structure in ensemble 0.279848 , delta G binding= -1.57
Free Energies:
AB		AA		BB		A		B
-5.838299	1.006546	-16.231717	-0.003662	-4.266495
Kaa..0.193006 266048 12.7351
Initial concentrations		relative Equilibrium concentrations
A		 B		 AB		 AA		 BB		 A		 B
10        	10        	0.01066 	0.14707 	0.24456 	0.19519 	0.00021

%!PS-Adobe-3.0 EPSF-3.0
%%Creator: ePS_dot.c,v 1.6 2008/06/26 08:40:00 rice Exp $, ViennaRNA-1.7.2
%%CreationDate: Sun Jul 15 12:00:00 2007
%%Title: RNA Secondary Structure Plot
%%BoundingBox: 66 210 518 662
%%DocumentFonts: Helvetica
%%Pages: 1
%%EndComments

%Options: 
% to switch off outline pairs of sequence comment or
% delete the appropriate line near the end of the file

%%BeginProlog
/RNAplot 100 dict def
RNAplot begin
/fsize  14 def
/outlinecolor {0.2 setgray} bind def
/paircolor    {0.2 setgray} bind def
/seqcolor     {0   setgray} bind def
/cshow  { dup stringwidth pop -2 div fsize -3 div rmoveto show} bind def
/min { 2 copy gt { exch } if pop } bind def
/max { 2 copy lt { exch } if pop } bind def
/drawoutline {
  gsave outlinecolor newpath
  coor 0 get aload pop 0.8 0 360 arc % draw 5' circle of 1st sequence
  currentdict /cutpoint known        % check if cutpoint is defined
  {coor 0 cutpoint getinterval
   {aload pop lineto} forall         % draw outline of 1st sequence
   coor cutpoint get aload pop
   2 copy moveto 0.8 0 360 arc       % draw 5' circle of 2nd sequence
   coor cutpoint coor length cutpoint sub getinterval
   {aload pop lineto} forall}        % draw outline of 2nd sequence
  {coor {aload pop lineto} forall}   % draw outline as a whole
  ifelse
  stroke grestore
} bind def
/drawpairs {
  paircolor
  0.7 setlinewidth
  [9 3.01] 9 setdash
  newpath
  pairs {aload pop
     coor exch 1 sub get aload pop moveto
     coor exch 1 sub get aload pop lineto
  } forall
  stroke
} bind def
% draw bases
/drawbases {


  [Part of this file has been deleted for brevity]

AUGAAGAUGACUGUCUGUCUUGAGACA\
) def
/coor [
[96.276 111.415]
[91.331 110.049]
[86.992 106.486]
[84.234 101.044]
[83.858 94.465]
[73.252 83.858]
[62.645 73.252]
[52.039 62.645]
[36.067 58.926]
[31.562 43.157]
[43.157 31.562]
[58.926 36.067]
[62.645 52.039]
[73.252 62.645]
[83.858 73.252]
[94.465 83.858]
[107.979 90.367]
[122.885 92.046]
[137.791 93.726]
[152.597 86.675]
[165.951 96.194]
[164.115 112.490]
[148.978 118.799]
[136.111 108.631]
[121.206 106.952]
[106.300 105.272]
[104.357 108.419]
] def
/pairs [
[5 16]
[6 15]
[7 14]
[8 13]
[17 26]
[18 25]
[19 24]
] def

init

% switch off outline pairs or bases by removing these lines
drawoutline
drawpairs
drawbases
% show it
showpage
end
%%EOF

%!PS-Adobe-3.0 EPSF-3.0
%%Title: RNA Dot Plot
%%Creator: ePS_dot.c,v 1.6 2008/06/26 08:40:00 rice Exp $, ViennaRNA-1.7.2
%%CreationDate: Sun Jul 15 12:00:00 2007
%%BoundingBox: 66 211 518 662
%%DocumentFonts: Helvetica
%%Pages: 1
%%EndComments

%Options: -d2 
% 
%Monomer A FreeEnergy= -0.003661585

%This file contains the square roots of the base pair probabilities in the form
% i  j  sqrt(p(i,j)) ubox

%%BeginProlog
/DPdict 100 dict def
DPdict begin
/logscale false def
/lpmin 1e-05 log def

/box { %size x y box - draws box centered on x,y
   2 index 0.5 mul sub            % x -= 0.5
   exch 2 index 0.5 mul sub exch  % y -= 0.5
   3 -1 roll dup rectfill
} bind def

/ubox {
   logscale {
      log dup add lpmin div 1 exch sub dup 0 lt { pop 0 } if
   } if
   3 1 roll
   exch len exch sub 1 add box
} bind def

/lbox {
   3 1 roll
   len exch sub 1 add box
} bind def

/drawseq {
% print sequence along all 4 sides
[ [0.7 -0.3 0 ]
  [0.7 0.7 len add 0]
  [-0.3 len sub -0.4 -90]
  [-0.3 len sub 0.7 len add -90]
] {
   gsave
    aload pop rotate translate


  [Part of this file has been deleted for brevity]

     len lineto 
     dup
     len exch sub 0 exch moveto
     len exch len exch sub lineto
     stroke
  } for
  [] 0 setdash
  0.04 setlinewidth 
  currentdict /cutpoint known {
    cutpoint 1 sub
    dup dup -1 moveto len 1 add lineto
    len exch sub dup
    -1 exch moveto len 1 add exch lineto
    stroke
  } if
  0.5 neg dup translate
} bind def

end
%%EndProlog
DPdict begin
%delete next line to get rid of title
270 665 moveto /Helvetica findfont 14 scalefont setfont (red.aps) show

/sequence { (\
AUGAAGAUGA\
) } def
/len { sequence length } bind def

72 216 translate
72 6 mul len 1 add div dup scale
/Helvetica findfont 0.95 scalefont setfont

drawseq
0.5 dup translate
% draw diagonal
0.04 setlinewidth
0 len moveto len 0 lineto stroke 

drawgrid
%data starts here
1 8 0.056921184 ubox
2 6 0.010665222 ubox
2 7 0.059657315 ubox
2 9 0.037641368 ubox
2 10 0.014667470 ubox
3 8 0.016991073 ubox
4 8 0.013136244 ubox
showpage
end
%%EOF

%!PS-Adobe-3.0 EPSF-3.0
%%Title: RNA Dot Plot
%%Creator: ePS_dot.c,v 1.6 2008/06/26 08:40:00 rice Exp $, ViennaRNA-1.7.2
%%CreationDate: Sun Jul 15 12:00:00 2007
%%BoundingBox: 66 211 518 662
%%DocumentFonts: Helvetica
%%Pages: 1
%%EndComments

%Options: -d2 
% 
%Homodimer AA FreeEnergy= 1.006545912

%This file contains the square roots of the base pair probabilities in the form
% i  j  sqrt(p(i,j)) ubox

%%BeginProlog
/DPdict 100 dict def
DPdict begin
/logscale false def
/lpmin 1e-05 log def

/box { %size x y box - draws box centered on x,y
   2 index 0.5 mul sub            % x -= 0.5
   exch 2 index 0.5 mul sub exch  % y -= 0.5
   3 -1 roll dup rectfill
} bind def

/ubox {
   logscale {
      log dup add lpmin div 1 exch sub dup 0 lt { pop 0 } if
   } if
   3 1 roll
   exch len exch sub 1 add box
} bind def

/lbox {
   3 1 roll
   len exch sub 1 add box
} bind def

/drawseq {
% print sequence along all 4 sides
[ [0.7 -0.3 0 ]
  [0.7 0.7 len add 0]
  [-0.3 len sub -0.4 -90]
  [-0.3 len sub 0.7 len add -90]
] {
   gsave
    aload pop rotate translate


  [Part of this file has been deleted for brevity]

0 len moveto len 0 lineto stroke 

drawgrid
%data starts here
1 8 0.012265566 ubox
1 12 0.215587153 ubox
1 18 0.288802765 ubox
2 6 0.007382632 ubox
2 7 0.017136911 ubox
2 9 0.006557723 ubox
2 11 0.215587153 ubox
2 13 0.177137725 ubox
2 14 0.261895917 ubox
2 15 0.174189834 ubox
2 16 0.162531888 ubox
2 17 0.302055878 ubox
2 19 0.178963082 ubox
2 20 0.138746812 ubox
3 8 0.007237926 ubox
3 12 0.177137725 ubox
3 18 0.177773670 ubox
4 8 0.006556812 ubox
4 12 0.261895917 ubox
4 18 0.190988815 ubox
5 12 0.174189834 ubox
5 18 0.177450624 ubox
6 12 0.162531888 ubox
6 18 0.147070716 ubox
7 12 0.302055878 ubox
7 18 0.394330909 ubox
8 11 0.288802765 ubox
8 13 0.177773670 ubox
8 14 0.190988815 ubox
8 15 0.177450624 ubox
8 16 0.147070716 ubox
8 17 0.394330909 ubox
8 19 0.176519887 ubox
8 20 0.098710624 ubox
9 12 0.178963082 ubox
9 18 0.176519887 ubox
10 12 0.138746812 ubox
10 18 0.098710624 ubox
11 18 0.012265566 ubox
12 16 0.007382632 ubox
12 17 0.017136911 ubox
12 19 0.006557723 ubox
13 18 0.007170919 ubox
14 18 0.006512656 ubox
showpage
end
%%EOF

%!PS-Adobe-3.0 EPSF-3.0
%%Title: RNA Dot Plot
%%Creator: ePS_dot.c,v 1.6 2008/06/26 08:40:00 rice Exp $, ViennaRNA-1.7.2
%%CreationDate: Sun Jul 15 12:00:00 2007
%%BoundingBox: 66 211 518 662
%%DocumentFonts: Helvetica
%%Pages: 1
%%EndComments

%Options: -d2 
% 
%Heterodimer AB FreeEnergy= -5.838299492

%This file contains the square roots of the base pair probabilities in the form
% i  j  sqrt(p(i,j)) ubox

%%BeginProlog
/DPdict 100 dict def
DPdict begin
/logscale false def
/lpmin 1e-05 log def

/box { %size x y box - draws box centered on x,y
   2 index 0.5 mul sub            % x -= 0.5
   exch 2 index 0.5 mul sub exch  % y -= 0.5
   3 -1 roll dup rectfill
} bind def

/ubox {
   logscale {
      log dup add lpmin div 1 exch sub dup 0 lt { pop 0 } if
   } if
   3 1 roll
   exch len exch sub 1 add box
} bind def

/lbox {
   3 1 roll
   len exch sub 1 add box
} bind def

/drawseq {
% print sequence along all 4 sides
[ [0.7 -0.3 0 ]
  [0.7 0.7 len add 0]
  [-0.3 len sub -0.4 -90]
  [-0.3 len sub 0.7 len add -90]
] {
   gsave
    aload pop rotate translate


  [Part of this file has been deleted for brevity]

6 26 0.010177101 ubox
7 12 0.021632770 ubox
7 14 0.855666290 ubox
7 16 0.007717878 ubox
7 18 0.452386699 ubox
7 20 0.003307306 ubox
8 13 0.832810588 ubox
8 17 0.442059430 ubox
8 27 0.013548766 ubox
9 11 0.178755395 ubox
9 12 0.506569088 ubox
9 14 0.016728359 ubox
9 15 0.203346599 ubox
9 16 0.245771341 ubox
9 19 0.006237182 ubox
9 26 0.012991150 ubox
10 12 0.036293322 ubox
10 14 0.184145302 ubox
10 16 0.016990375 ubox
10 18 0.005640224 ubox
11 17 0.008558761 ubox
12 25 0.008108337 ubox
12 27 0.080028280 ubox
13 26 0.180825466 ubox
14 23 0.012679048 ubox
14 25 0.181430593 ubox
15 22 0.012950484 ubox
15 24 0.181499570 ubox
16 22 0.007039813 ubox
16 23 0.171288889 ubox
16 27 0.300268293 ubox
17 21 0.005675580 ubox
17 26 0.853563809 ubox
18 22 0.006794027 ubox
18 23 0.006526663 ubox
18 24 0.003206525 ubox
18 25 0.854300760 ubox
19 24 0.849253823 ubox
20 25 0.003296357 ubox
21 27 0.009002471 ubox
22 26 0.014858566 ubox
17 26 0.9746794 lbox
18 25 0.9746794 lbox
19 24 0.9746794 lbox
5 16 0.9746794 lbox
6 15 0.9746794 lbox
7 14 0.9746794 lbox
8 13 0.9746794 lbox
showpage
end
%%EOF

%!PS-Adobe-3.0 EPSF-3.0
%%Title: RNA Dot Plot
%%Creator: ePS_dot.c,v 1.6 2008/06/26 08:40:00 rice Exp $, ViennaRNA-1.7.2
%%CreationDate: Sun Jul 15 12:00:00 2007
%%BoundingBox: 66 211 518 662
%%DocumentFonts: Helvetica
%%Pages: 1
%%EndComments

%Options: -d2 
% 
%Monomer B FreeEnergy= -4.266494644

%This file contains the square roots of the base pair probabilities in the form
% i  j  sqrt(p(i,j)) ubox

%%BeginProlog
/DPdict 100 dict def
DPdict begin
/logscale false def
/lpmin 1e-05 log def

/box { %size x y box - draws box centered on x,y
   2 index 0.5 mul sub            % x -= 0.5
   exch 2 index 0.5 mul sub exch  % y -= 0.5
   3 -1 roll dup rectfill
} bind def

/ubox {
   logscale {
      log dup add lpmin div 1 exch sub dup 0 lt { pop 0 } if
   } if
   3 1 roll
   exch len exch sub 1 add box
} bind def

/lbox {
   3 1 roll
   len exch sub 1 add box
} bind def

/drawseq {
% print sequence along all 4 sides
[ [0.7 -0.3 0 ]
  [0.7 0.7 len add 0]
  [-0.3 len sub -0.4 -90]
  [-0.3 len sub 0.7 len add -90]
] {
   gsave
    aload pop rotate translate


  [Part of this file has been deleted for brevity]

} bind def

end
%%EndProlog
DPdict begin
%delete next line to get rid of title
270 665 moveto /Helvetica findfont 14 scalefont setfont (red.bps) show

/sequence { (\
CUGUCUGUCUUGAGACA\
) } def
/len { sequence length } bind def

72 216 translate
72 6 mul len 1 add div dup scale
/Helvetica findfont 0.95 scalefont setfont

drawseq
0.5 dup translate
% draw diagonal
0.04 setlinewidth
0 len moveto len 0 lineto stroke 

drawgrid
%data starts here
1 14 0.005240367 ubox
2 13 0.004453976 ubox
2 15 0.020976246 ubox
2 17 0.670298457 ubox
3 9 0.003276457 ubox
3 16 0.947914389 ubox
4 13 0.030267916 ubox
4 15 0.948345709 ubox
5 12 0.031100569 ubox
5 14 0.948406578 ubox
6 12 0.036122707 ubox
6 13 0.895017467 ubox
6 17 0.221479258 ubox
7 11 0.028943407 ubox
7 16 0.313227070 ubox
8 12 0.034859252 ubox
8 13 0.014451769 ubox
8 15 0.313262201 ubox
9 14 0.311389763 ubox
3 16 0.9746794 lbox
4 15 0.9746794 lbox
5 14 0.9746794 lbox
6 13 0.9746794 lbox
showpage
end
%%EOF

%!PS-Adobe-3.0 EPSF-3.0
%%Title: RNA Dot Plot
%%Creator: ePS_dot.c,v 1.6 2008/06/26 08:40:00 rice Exp $, ViennaRNA-1.7.2
%%CreationDate: Sun Jul 15 12:00:00 2007
%%BoundingBox: 66 211 518 662
%%DocumentFonts: Helvetica
%%Pages: 1
%%EndComments

%Options: -d2 
% 
%Homodimer BB FreeEnergy= -16.231717299

%This file contains the square roots of the base pair probabilities in the form
% i  j  sqrt(p(i,j)) ubox

%%BeginProlog
/DPdict 100 dict def
DPdict begin
/logscale false def
/lpmin 1e-05 log def

/box { %size x y box - draws box centered on x,y
   2 index 0.5 mul sub            % x -= 0.5
   exch 2 index 0.5 mul sub exch  % y -= 0.5
   3 -1 roll dup rectfill
} bind def

/ubox {
   logscale {
      log dup add lpmin div 1 exch sub dup 0 lt { pop 0 } if
   } if
   3 1 roll
   exch len exch sub 1 add box
} bind def

/lbox {
   3 1 roll
   len exch sub 1 add box
} bind def

/drawseq {
% print sequence along all 4 sides
[ [0.7 -0.3 0 ]
  [0.7 0.7 len add 0]
  [-0.3 len sub -0.4 -90]
  [-0.3 len sub 0.7 len add -90]
] {
   gsave
    aload pop rotate translate


  [Part of this file has been deleted for brevity]

/cutpoint 18 def

72 216 translate
72 6 mul len 1 add div dup scale
/Helvetica findfont 0.95 scalefont setfont

drawseq
0.5 dup translate
% draw diagonal
0.04 setlinewidth
0 len moveto len 0 lineto stroke 

drawgrid
%data starts here
1 7 0.003236657 ubox
2 34 0.009973148 ubox
3 33 0.012492742 ubox
4 32 0.010908837 ubox
4 34 0.009627671 ubox
5 31 0.009623480 ubox
6 30 0.006572250 ubox
6 34 0.706535967 ubox
7 33 0.999219530 ubox
8 32 0.999724559 ubox
9 31 0.999930230 ubox
10 30 0.999844032 ubox
11 29 0.525401232 ubox
12 28 0.525401232 ubox
13 23 0.006572250 ubox
13 27 0.999844032 ubox
14 22 0.009623480 ubox
14 26 0.999930230 ubox
15 21 0.010908837 ubox
15 25 0.999724559 ubox
16 20 0.012492742 ubox
16 24 0.999219530 ubox
17 19 0.009973148 ubox
17 21 0.009627671 ubox
17 23 0.706535967 ubox
18 24 0.003236657 ubox
7 33 0.9746794 lbox
8 32 0.9746794 lbox
9 31 0.9746794 lbox
10 30 0.9746794 lbox
13 27 0.9746794 lbox
14 26 0.9746794 lbox
15 25 0.9746794 lbox
16 24 0.9746794 lbox
showpage
end
%%EOF