|
|
vrnaalifoldpf |
The original program produces different outputs, depending on the options selected. In the EMBASSY implementation it is split into vrnaalifold and vrnaalifoldpf
% vrnaalifoldpf RNA alignment folding with partition Input (aligned) nucleotide sequence set: ecoli6s.fasta Vienna RNAfold output file [ecoli6s.vrnaalifoldpf]: |
Go to the input files for this example
Go to the output files for this example
Standard (Mandatory) qualifiers:
[-sequence] seqset (Aligned) nucleotide sequence set filename
and optional format, or reference (input
USA)
[-outfile] outfile [*.vrnaalifoldpf] Vienna RNAfold output file
Additional (Optional) qualifiers: (none)
Advanced (Unprompted) qualifiers:
-constraintfile infile Vienna RNA structure constraints file
(optional)
-paramfile infile Vienna RNA parameters file (optional)
-temperature float [37.0] Temperature (Any numeric value)
-[no]gu boolean [Y] Allow GU pairs
-[no]closegu boolean [Y] Allow GU pairs at end of helices
-[no]lp boolean [Y] Allow lonely pairs
-[no]convert boolean [Y] Convert T to U
-nsbases string Non-standard bases (Any string is accepted)
-[no]tetraloop boolean [Y] Stabilizing energies for tetra-loops
-circular boolean [N] Circular RNA
-colour boolean [N] Colour structure plot
-energy menu [0] Rarely used option to fold sequences
from the ABCD... alphabet (Values: 0 (BP); 1
(Any with GC); 2 (Any with AU parameters))
-scale float [1.07] Estimate of ensemble free energy (Any
numeric value)
-dangles menu [2] Method (Values: 0 (Ignore); 1 (Only
unpaired bases for just one dangling end); 2
(Always use dangling energies); 3 (Allow
coaxial stacking of adjacent helices))
-covariance float [1.0] Weight for covariance (Any numeric
value)
-nspenalty float [1.0] Non-compatible sequence penalty (Any
numeric value)
-endgaps boolean [N] Mark end gaps
-most boolean [N] Use most informative sequence algorithm
-dotoutfile outfile [*.vrnaalifoldpf] Vienna dotplot postscript
output file
-ssoutfile outfile [*.vrnaalifoldpf] Vienna structure
postscript output file
-alignoutfile outfile [*.vrnaalifoldpf] Vienna alignment colour
postscript output file
Associated qualifiers:
"-sequence" associated qualifiers
-sbegin1 integer Start of each sequence to be used
-send1 integer End of each sequence to be used
-sreverse1 boolean Reverse (if DNA)
-sask1 boolean Ask for begin/end/reverse
-snucleotide1 boolean Sequence is nucleotide
-sprotein1 boolean Sequence is protein
-slower1 boolean Make lower case
-supper1 boolean Make upper case
-sformat1 string Input sequence format
-sdbname1 string Database name
-sid1 string Entryname
-ufo1 string UFO features
-fformat1 string Features format
-fopenfile1 string Features file name
"-outfile" associated qualifiers
-odirectory2 string Output directory
"-dotoutfile" associated qualifiers
-odirectory string Output directory
"-ssoutfile" associated qualifiers
-odirectory string Output directory
"-alignoutfile" associated qualifiers
-odirectory string Output directory
General qualifiers:
-auto boolean Turn off prompts
-stdout boolean Write first file to standard output
-filter boolean Read first file from standard input, write
first file to standard output
-options boolean Prompt for standard and additional values
-debug boolean Write debug output to program.dbg
-verbose boolean Report some/full command line options
-help boolean Report command line options. More
information on associated and general
qualifiers can be found with -help -verbose
-warning boolean Report warnings
-error boolean Report errors
-fatal boolean Report fatal errors
-die boolean Report dying program messages
|
| Standard (Mandatory) qualifiers | Allowed values | Default | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| [-sequence] (Parameter 1) |
(Aligned) nucleotide sequence set filename and optional format, or reference (input USA) | Readable set of sequences | Required | ||||||||
| [-outfile] (Parameter 2) |
Vienna RNAfold output file | Output file | <*>.vrnaalifoldpf | ||||||||
| Additional (Optional) qualifiers | Allowed values | Default | |||||||||
| (none) | |||||||||||
| Advanced (Unprompted) qualifiers | Allowed values | Default | |||||||||
| -constraintfile | Vienna RNA structure constraints file (optional) | Input file | Required | ||||||||
| -paramfile | Vienna RNA parameters file (optional) | Input file | Required | ||||||||
| -temperature | Temperature | Any numeric value | 37.0 | ||||||||
| -[no]gu | Allow GU pairs | Boolean value Yes/No | Yes | ||||||||
| -[no]closegu | Allow GU pairs at end of helices | Boolean value Yes/No | Yes | ||||||||
| -[no]lp | Allow lonely pairs | Boolean value Yes/No | Yes | ||||||||
| -[no]convert | Convert T to U | Boolean value Yes/No | Yes | ||||||||
| -nsbases | Non-standard bases | Any string is accepted | An empty string is accepted | ||||||||
| -[no]tetraloop | Stabilizing energies for tetra-loops | Boolean value Yes/No | Yes | ||||||||
| -circular | Circular RNA | Boolean value Yes/No | No | ||||||||
| -colour | Colour structure plot | Boolean value Yes/No | No | ||||||||
| -energy | Rarely used option to fold sequences from the ABCD... alphabet |
|
0 | ||||||||
| -scale | Estimate of ensemble free energy | Any numeric value | 1.07 | ||||||||
| -dangles | Method |
|
2 | ||||||||
| -covariance | Weight for covariance | Any numeric value | 1.0 | ||||||||
| -nspenalty | Non-compatible sequence penalty | Any numeric value | 1.0 | ||||||||
| -endgaps | Mark end gaps | Boolean value Yes/No | No | ||||||||
| -most | Use most informative sequence algorithm | Boolean value Yes/No | No | ||||||||
| -dotoutfile | Vienna dotplot postscript output file | Output file | <*>.vrnaalifoldpf | ||||||||
| -ssoutfile | Vienna structure postscript output file | Output file | <*>.vrnaalifoldpf | ||||||||
| -alignoutfile | Vienna alignment colour postscript output file | Output file | <*>.vrnaalifoldpf | ||||||||
>X01238.1/1-183 AUUUCUCUGAGAUGUUCGCAAGCGGGC.CAGUCCCCUGAGCCGAUAUUUCAUACCACAAG AAUGUGGCGCUCCGCGGUUGGUGAGCAUGCUCGGUCCGU...............CCGAGA AGCCUUAAAACUGCGACGACACAUUCACCUUGAACCAA.GGGUUCAAGGGUUACAGCCUG CGGCGGCA.UC.UCGGAG.AUUC >AL627277.1/108623-108805 AUUUCUCUGAGAUGUUUGCAAGCGGGC.CAGUCCCCUGAGCCGAUAUUUCAUACCACAAG AAUGUGGCGCUCCGCGGUUGGUGAGCAUGCUCGGUUCGU...............CCGAGA AGCCUUAAAACUGUGACGACACAUUCACCUUGAACCAA.GGGUUCAAGGGUUACAGCCUG CGGCGGCA.UC.UCGGAG.AUUC >AJ414145.1/90993-91174 AUUUCUCUGAGGUGUUUGCCAGCGGGC.CAGUCCCCUGAGCCGAUAUUUAAUACCAACAG AAUGUAGUGCUCCGUAACCGGUGAGCAUGCUCGGUCCG................CCGAGA AGCCUUAAGGUUGCGACGCUGCGUUCACCUUGAACCAA.GGGUUCAAGGGUUACAGCCUG CGACGGCA.CC.UCGGAG.AUCC >U32767.1/6538-6734 .AUUACCUGGAGUGUUCGUCAGUAGGC.UAUGUCCCUGAGCCGAUACUUUAAAUCUUAUA AAUU.GGUUUCCUAUCGUUGGUGUGUAGGCUUAACCUUUGACUCGUUCAUUGGGCUAAGA AACCUGAAAACGGUAUCAACUGAUUU.CCUUGAACCGUCGGGUUCAAGGACUACUGCCCG CAGCGGCACUC.UGGGGU.CUUC >AE006208.1/8365-8185 .AUUACCUGAGGUGUUUGCCAGUGGGU.UAUGUCCCUGAGCCGAUACUUU.UAUUUUAUG AAUC.GGUUUCUAAUUGUUGGUGUGCAUGCUUAGCUUGA...............CUAAGA AGCCUAAAAAUAGUUAUAACUGAUUC.CCUUGAACCGUUGGGUUCAAGGACUGAGACUUG CAGCGGCA.UC.UCGGGUUCUUC >Y00334.1/77-254 CGCUCCCUGGUGUGUUGGCCAGUCGGU.GAUGUCCCUGAGCCGAUAACUGCAACAAC..G GAGGUUGC.CAGUUGGACCGGUGUGCAUGUCCGCACG.................ACGGAA AGCCUUAAGGUCUAC.UGCAACCGCCACCUUGAACUUUCGGGUUCAAGGGCUA.ACCCGA CAGCGGCA.CGACCGGGG.AGCU >AE004317.1/5626-5807 UUUACCCUGGGGUGUUCGUCAGCGGAUUUAUGUCCCUGAGCCGAUAAGCAACAUAAC..A GGGUUGGUAUUGGGUAGCUAUUGAGCAAGCUCGGCUUGUA..............CCGAGA AGCCUGCGGUUACCAUUACUGAUCCG.CCUUGAACCUGAUGGUUCAAGGGCUACGAUCCU CAACGGCA.UC.CCGGGG.UUC. |
%!PS-Adobe-3.0 EPSF-3.0
%%Creator: ePS_dot.c,v 1.6 2008/06/26 08:40:00 rice Exp $, ViennaRNA-1.7.2
%%CreationDate: Sun Jul 15 12:00:00 2007
%%Title: RNA Secondary Structure Plot
%%BoundingBox: 66 210 518 662
%%DocumentFonts: Helvetica
%%Pages: 1
%%EndComments
%Options: -d2
% to switch off outline pairs of sequence comment or
% delete the appropriate line near the end of the file
%%BeginProlog
/RNAplot 100 dict def
RNAplot begin
/fsize 14 def
/outlinecolor {0.2 setgray} bind def
/paircolor {0.2 setgray} bind def
/seqcolor {0 setgray} bind def
/cshow { dup stringwidth pop -2 div fsize -3 div rmoveto show} bind def
/min { 2 copy gt { exch } if pop } bind def
/max { 2 copy lt { exch } if pop } bind def
/drawoutline {
gsave outlinecolor newpath
coor 0 get aload pop 0.8 0 360 arc % draw 5' circle of 1st sequence
currentdict /cutpoint known % check if cutpoint is defined
{coor 0 cutpoint getinterval
{aload pop lineto} forall % draw outline of 1st sequence
coor cutpoint get aload pop
2 copy moveto 0.8 0 360 arc % draw 5' circle of 2nd sequence
coor cutpoint coor length cutpoint sub getinterval
{aload pop lineto} forall} % draw outline of 2nd sequence
{coor {aload pop lineto} forall} % draw outline as a whole
ifelse
stroke grestore
} bind def
/drawpairs {
paircolor
0.7 setlinewidth
[9 3.01] 9 setdash
newpath
pairs {aload pop
coor exch 1 sub get aload pop moveto
coor exch 1 sub get aload pop lineto
} forall
stroke
} bind def
% draw bases
/drawbases {
[Part of this file has been deleted for brevity]
60 cmark
146 cmark
61 cmark
145 cmark
62 144 1 gmark
62 cmark
144 cmark
63 cmark
143 cmark
64 cmark
142 cmark
65 141 2 gmark
141 cmark
66 cmark
140 cmark
73 135 2 gmark
73 cmark
135 cmark
74 cmark
134 cmark
75 133 1 gmark
75 cmark
133 cmark
76 132 1 gmark
76 cmark
132 cmark
77 cmark
131 cmark
78 130 1 gmark
78 cmark
130 cmark
79 cmark
129 cmark
86 cmark
122 cmark
90 cmark
119 cmark
91 cmark
118 cmark
92 cmark
117 cmark
93 cmark
116 cmark
94 115 2 gmark
156 cmark
% End Annotations
% show it
showpage
end
%%EOF
|
![[vrnaalifoldpf results]](vrnaalifoldpf.1.ecoli6s.gif)
%!PS-Adobe-3.0 EPSF-3.0
%%BoundingBox: 0 0 576 428
%%EndComments
% draws Vienna RNA like colored boxes
/box { % x1 y1 x2 y2 hue saturation
gsave
dup 0.3 mul 1 exch sub sethsbcolor
exch 3 index sub exch 2 index sub rectfill
grestore
} def
% draws a box in current color
/box2 { % x1 y1 x2 y2
exch 3 index sub exch 2 index sub rectfill
} def
/string { % (Text) x y
6 add
moveto
show
} def
0 428 translate
1 -1 scale
/Courier findfont
[10 0 0 -10 0 0] makefont setfont
192.0 11.5 198.0 20.0 0.16 1 box
192.0 20.0 198.0 28.5 0.16 1 box
192.0 28.5 198.0 37.0 0.16 1 box
192.0 37.0 198.0 45.5 0.16 1 box
192.0 45.5 198.0 54.0 0.16 1 box
192.0 54.0 198.0 62.5 0.16 1 box
192.0 62.5 198.0 71.0 0.16 1 box
270.0 331.0 276.0 339.5 0.16 1 box
270.0 339.5 276.0 348.0 0.16 1 box
270.0 348.0 276.0 356.5 0.16 1 box
270.0 356.5 276.0 365.0 0.16 1 box
270.0 365.0 276.0 373.5 0.16 1 box
270.0 373.5 276.0 382.0 0.16 1 box
270.0 382.0 276.0 390.5 0.16 1 box
198.0 11.5 204.0 20.0 0.16 1 box
198.0 20.0 204.0 28.5 0.16 1 box
198.0 28.5 204.0 37.0 0.16 1 box
198.0 37.0 204.0 45.5 0.16 1 box
198.0 45.5 204.0 54.0 0.16 1 box
198.0 54.0 204.0 62.5 0.16 1 box
198.0 62.5 204.0 71.0 0.16 1 box
264.0 331.0 270.0 339.5 0.16 1 box
264.0 339.5 270.0 348.0 0.16 1 box
264.0 348.0 270.0 356.5 0.16 1 box
264.0 356.5 270.0 365.0 0.16 1 box
264.0 365.0 270.0 373.5 0.16 1 box
264.0 373.5 270.0 382.0 0.16 1 box
[Part of this file has been deleted for brevity]
516.0 306.9 522.0 315.0 box2
522.0 304.2 528.0 315.0 box2
0 setgray
(\).\)\)\)\)\)\).\)\).\)\)\)\)\)\).....) 168.0 321.5 string
(X01238.1/1-183) 6.0 332.0 string
(CGGCGGCA-UC-UCGGAG-AUUC) 168.0 332.0 string
(183) 312.0 332.0 string
(AL627277.1/108623-108805) 6.0 340.5 string
(CGGCGGCA-UC-UCGGAG-AUUC) 168.0 340.5 string
(183) 312.0 340.5 string
(AJ414145.1/90993-91174) 6.0 349.0 string
(CGACGGCA-CC-UCGGAG-AUCC) 168.0 349.0 string
(182) 312.0 349.0 string
(U32767.1/6538-6734) 6.0 357.5 string
(CAGCGGCACUC-UGGGGU-CUUC) 168.0 357.5 string
(197) 312.0 357.5 string
(AE006208.1/8365-8185) 6.0 366.0 string
(CAGCGGCA-UC-UCGGGUUCUUC) 168.0 366.0 string
(181) 312.0 366.0 string
(Y00334.1/77-254) 6.0 374.5 string
(CAGCGGCA-CGACCGGGG-AGCU) 168.0 374.5 string
(178) 312.0 374.5 string
(AE004317.1/5626-5807) 6.0 383.0 string
(CAACGGCA-UC-CCGGGG-UUC-) 168.0 383.0 string
(182) 312.0 383.0 string
(.........190.......200.) 168.0 393.5 string
0.6 setgray
168.0 405.2 174.0 421.5 box2
174.0 413.4 180.0 421.5 box2
180.0 410.7 186.0 421.5 box2
186.0 405.2 192.0 421.5 box2
192.0 405.2 198.0 421.5 box2
198.0 405.2 204.0 421.5 box2
204.0 405.2 210.0 421.5 box2
210.0 405.2 216.0 421.5 box2
216.0 420.5 222.0 421.5 box2
222.0 410.7 228.0 421.5 box2
228.0 408.0 234.0 421.5 box2
234.0 420.5 240.0 421.5 box2
240.0 410.7 246.0 421.5 box2
246.0 408.0 252.0 421.5 box2
252.0 405.2 258.0 421.5 box2
258.0 405.2 264.0 421.5 box2
264.0 413.4 270.0 421.5 box2
270.0 410.7 276.0 421.5 box2
276.0 420.5 282.0 421.5 box2
282.0 413.4 288.0 421.5 box2
288.0 408.0 294.0 421.5 box2
294.0 413.4 300.0 421.5 box2
300.0 410.7 306.0 421.5 box2
showpage
|
AUUUCCCUGAGGUGUUCGCCAGCGGGC_CAUGUCCCUGAGCCGAUAUUUAAUACCACAAGAAUGUGGUGCUCCGUGGUUGGUGAGCAUGCUCGGCCCGU_______________CCGAGAAGCCUUAAAAUUGCGACGACACAUUCACCUUGAACCAA_GGGUUCAAGGGCUACAGCCUGCAGCGGCA_UC_UCGGGG_AUUC
....(((((((((((.(((..((((((................................(((((((......(((((((...(.((...(((((....................)))))..)))....)))))))....))))))).(((((((((....)))))))))......)))))).)))))).)).))))))..... (-56.91 = -48.71 + -8.20)
....(((((((((({{(((..((((((................................(((((((......(((((((...{.((...(((((....................)))))..)),....)))))))..,.))))))).(((((((((....)))))))))......)))))).)))))).)).))))))..... [-59.30]
frequency of mfe structure in ensemble 0.0206905
# Alignment section
7 sequences; length of alignment 203
alifold output
64 142 0 100.0% 0.000 CG:1 GC:4 UG:1 UA:1
63 143 0 99.9% 0.002 GC:1 GU:1 UG:1 UA:4
74 134 0 99.8% 0.005 GC:3 GU:1 AU:2 UA:1
77 131 0 100.0% 0.001 GC:3 GU:2 AU:2
10 193 0 99.8% 0.006 GC:2 GU:1 AU:4
76 132 1 99.9% 0.003 CG:1 GC:1 GU:2 AU:1 UA:1
79 129 0 99.3% 0.032 CG:2 UG:1 UA:4
66 140 0 98.3% 0.056 GC:4 GU:1 AU:1 UA:1
92 117 0 100.0% 0.000 CG:5 UA:2
91 118 0 100.0% 0.001 CG:1 UA:6
6 197 0 100.0% 0.001 CG:4 UA:3
90 119 0 99.9% 0.003 CG:6 UA:1
61 145 0 99.8% 0.005 GC:2 AU:5
93 116 0 99.8% 0.007 GC:5 AU:2
75 133 1 99.9% 0.003 CG:2 GU:1 UG:3
7 196 0 100.0% 0.000 CG:7
78 130 1 99.9% 0.010 CG:2 UA:4
8 195 0 99.8% 0.007 UG:7
62 144 1 99.7% 0.010 GC:1 AU:5
9 194 1 99.9% 0.003 GC:6
86 122 0 98.0% 0.083 CG:6 UA:1
65 141 2 99.1% 0.028 UG:2 UA:3
60 146 1 98.4% 0.050 GC:5 AU:1
152 165 0 98.0% 0.170 GC:7
155 162 0 98.0% 0.170 CG:7
85 123 0 97.9% 0.102 GC:7
153 164 0 97.9% 0.141 AU:7
154 163 0 97.9% 0.142 AU:7
151 166 0 97.5% 0.170 UA:7
5 198 0 96.3% 0.110 CG:5 AU:2
150 167 0 96.2% 0.158 UA:7
25 178 0 95.2% 0.329 GC:6 GU:1
26 177 0 95.1% 0.319 GC:6 AU:1
23 180 1 95.0% 0.199 CG:3 UG:2 UA:1
24 179 1 95.0% 0.320 CG:1 GC:1 GU:4
22 181 0 93.7% 0.311 GC:7
149 168 0 93.7% 0.404 CG:7
156 161 0 92.4% 0.322 CG:6 UG:1
27 176 1 91.6% 0.277 CG:4 UA:2
18 184 0 90.9% 0.490 GC:7
73 135 2 88.8% 0.331 CG:3 AU:1 UA:1
[Part of this file has been deleted for brevity]
25 36 0 0.6% 0.518 GC:7 +
24 37 1 0.6% 0.725 GU:5 AU:1 +
85 124 0 0.3% 0.462 GC:7 +
101 107 0 0.3% 0.080 AU:1 --:6 +
16 188 0 0.3% 0.831 UA:7 +
102 114 0 0.2% 0.070 CG:1 --:6 +
103 113 0 0.2% 0.070 UG:1 --:6 +
104 112 0 0.2% 0.052 CG:1 --:6 +
34 38 0 0.2% 0.894 CG:7 +
16 25 0 0.2% 0.927 UG:7 +
101 110 0 0.2% 0.061 AU:1 --:6 +
34 43 0 0.2% 0.658 CG:7 +
38 42 0 0.2% 0.938 GC:7 +
37 43 0 0.1% 0.727 UG:7 +
105 111 0 0.1% 0.030 GU:1 --:6 +
101 106 0 0.1% 0.063 AU:1 --:6 +
148 152 0 0.1% 0.237 CG:7 +
35 43 0 0.1% 0.641 CG:7 +
25 35 0 0.1% 0.629 GC:7 +
84 126 2 0.1% 0.039 UG:1 AU:3 UA:1 +
103 114 0 0.1% 0.071 UG:1 --:6 +
107 114 0 0.1% 0.072 UG:1 --:6 +
36 169 0 0.1% 0.882 CG:7 +
156 160 1 0.1% 0.158 CG:5 UG:1 +
104 113 0 0.1% 0.058 CG:1 --:6 +
15 188 0 0.1% 0.501 UA:7 +
35 40 0 0.1% 0.939 CG:7 +
155 160 1 0.5% 0.136 CG:6 +
26 35 1 0.5% 0.639 GC:6 +
81 126 2 0.2% 0.101 GU:4 UG:1 +
40 47 2 0.2% 0.584 GC:2 GU:3 +
81 123 1 0.4% 0.129 GC:6 +
80 124 1 0.4% 0.460 GC:6 +
151 157 2 0.2% 0.073 UG:2 UA:3 +
70 135 2 0.2% 0.499 CG:3 UA:2 +
82 127 1 0.3% 0.077 UA:6 +
81 125 1 0.3% 0.339 GU:6 +
19 182 2 0.1% 0.249 CG:3 UA:2 +
67 72 2 0.1% 0.036 GC:4 GU:1 +
79 128 2 0.1% 0.028 UG:1 UA:4 +
81 124 1 0.2% 0.483 GC:6 +
149 160 1 0.2% 0.141 CG:6 +
14 191 1 0.1% 0.284 GC:6 +
26 34 1 0.1% 0.634 GC:6 +
148 160 1 0.1% 0.241 CG:6 +
44 49 1 0.1% 0.062 AU:6 +
39 48 2 0.2% 0.416 AU:5 +
35 170 2 0.2% 1.006 CG:5 +
24 36 2 0.1% 0.486 GC:5 +
20 25 2 0.1% 0.419 CG:5 +
....(((((((((({{(((..((((((................................(((((((......(((((((...{.((...(((((....................)))))..)),....)))))))..,.))))))).(((((((((....)))))))))......)))))).)))))).)).)))))).....
|
| Program name | Description |
|---|---|
| einverted | Finds inverted repeats in nucleotide sequences |
| vrnaalifold | RNA alignment folding |
| vrnacofold | RNA cofolding |
| vrnacofoldconc | RNA cofolding with concentrations |
| vrnacofoldpf | RNA cofolding with partitioning |
| vrnadistance | RNA distances |
| vrnaduplex | RNA duplex calculation |
| vrnaeval | RNA eval |
| vrnaevalpair | RNA eval with cofold |
| vrnafold | Calculate secondary structures of RNAs |
| vrnafoldpf | Secondary structures of RNAs with partition |
| vrnaheat | RNA melting |
| vrnainverse | RNA sequences matching a structure |
| vrnalfold | Calculate locally stable secondary structures of RNAs |
| vrnaplot | Plot vrnafold output |
| vrnasubopt | Calculate RNA suboptimals |
Although we take every care to ensure that the results of the EMBOSS version are identical to those from the original package, we recommend that you check your inputs give the same results in both versions before publication.
Please report all bugs in the EMBOSS version to the EMBOSS bug team, not to the original author.