Standard (Mandatory) qualifiers:
  [-structuresfile]    infile     Vienna RNAfold output file
  [-outfile]           outfile    [*.vrnaplot] Vienna RNAfold output file

   Additional (Optional) qualifiers: (none)
   Advanced (Unprompted) qualifiers:
   -layout             menu       [naview] Layout (Values: radial (Simple
                                  radial); naview (naview))
   -optype             menu       [ps] Type (Values: ps (postscript); gml
                                  (graph meta language); svg (scaleable vector
                                  graphics); xrna (XRNA save file))
   -pre                string     Pre-annotation (Any string is accepted)
   -post               string     Post-annotation (Any string is accepted)

   Associated qualifiers:

   "-outfile" associated qualifiers
   -odirectory2        string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write first file to standard output
   -filter             boolean    Read first file from standard input, write
                                  first file to standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages

CACUACUCCAAGGACCGUAUCUUUCUCAGUGCGACAGUAA
.(((..((....)).(((((........)))))..))).. ( -3.50)

%!PS-Adobe-3.0 EPSF-3.0
%%Creator: ePS_dot.c,v 1.6 2008/06/26 08:40:00 rice Exp $, ViennaRNA-1.7.2
%%CreationDate: Sun Jul 15 12:00:00 2007
%%Title: RNA Secondary Structure Plot
%%BoundingBox: 66 210 518 662
%%DocumentFonts: Helvetica
%%Pages: 1
%%EndComments

%Options: 
% to switch off outline pairs of sequence comment or
% delete the appropriate line near the end of the file

%%BeginProlog
/RNAplot 100 dict def
RNAplot begin
/fsize  14 def
/outlinecolor {0.2 setgray} bind def
/paircolor    {0.2 setgray} bind def
/seqcolor     {0   setgray} bind def
/cshow  { dup stringwidth pop -2 div fsize -3 div rmoveto show} bind def
/min { 2 copy gt { exch } if pop } bind def
/max { 2 copy lt { exch } if pop } bind def
/drawoutline {
  gsave outlinecolor newpath
  coor 0 get aload pop 0.8 0 360 arc % draw 5' circle of 1st sequence
  currentdict /cutpoint known        % check if cutpoint is defined
  {coor 0 cutpoint getinterval
   {aload pop lineto} forall         % draw outline of 1st sequence
   coor cutpoint get aload pop
   2 copy moveto 0.8 0 360 arc       % draw 5' circle of 2nd sequence
   coor cutpoint coor length cutpoint sub getinterval
   {aload pop lineto} forall}        % draw outline of 2nd sequence
  {coor {aload pop lineto} forall}   % draw outline as a whole
  ifelse
  stroke grestore
} bind def
/drawpairs {
  paircolor
  0.7 setlinewidth
  [9 3.01] 9 setdash
  newpath
  pairs {aload pop
     coor exch 1 sub get aload pop moveto
     coor exch 1 sub get aload pop lineto
  } forall
  stroke
} bind def
% draw bases
/drawbases {


  [Part of this file has been deleted for brevity]

[76.515 91.594]
[88.932 77.646]
[107.552 76.227]
[116.182 63.958]
[124.812 51.689]
[133.442 39.420]
[142.071 27.151]
[136.924 12.513]
[141.395 -2.346]
[153.767 -11.712]
[169.282 -11.983]
[181.974 -3.056]
[186.962 11.637]
[182.330 26.446]
[169.857 35.678]
[154.340 35.781]
[145.711 48.050]
[137.081 60.319]
[128.451 72.587]
[119.821 84.856]
[124.925 99.035]
[120.932 113.567]
[109.299 123.146]
[110.447 138.102]
[111.596 153.058]
[121.300 166.278]
[114.456 181.181]
] def
/pairs [
[2 38]
[3 37]
[4 36]
[7 14]
[8 13]
[16 33]
[17 32]
[18 31]
[19 30]
[20 29]
] def

init

% switch off outline pairs or bases by removing these lines
drawoutline
drawpairs
drawbases
% show it
showpage
end
%%EOF