Standard (Mandatory) qualifiers:
  [-sequence]          sequence   Nucleotide sequence filename and optional
                                  format, or reference (input USA)
  [-outfile]           outfile    [*.vrnafoldpf] Vienna RNAfold output file

   Additional (Optional) qualifiers: (none)
   Advanced (Unprompted) qualifiers:
   -constraintfile     infile     Vienna RNA structure constraints file
                                  (optional)
   -paramfile          infile     Vienna RNA parameters file (optional)
   -temperature        float      [37.0] Temperature (Any numeric value)
   -circular           boolean    [N] Allow circular RNA
   -[no]gu             boolean    [Y] Allow GU pairs
   -[no]closegu        boolean    [Y] Allow GU pairs at end of helices
   -[no]lp             boolean    [Y] Allow lonely pairs
   -[no]convert        boolean    [Y] Convert T to U
   -nsbases            string     Non-standard bases (Any string is accepted)
   -[no]tetraloop      boolean    [Y] Stabilizing energies for tetra-loops
   -energy             menu       [0] Rarely used option to fold sequences
                                  from the ABCD... alphabet (Values: 0 (BP); 1
                                  (Any with GC); 2 (Any with AU parameters))
   -scale              float      [1.07] Estimate of ensemble free energy (Any
                                  numeric value)
   -dangles            menu       [1] Method (Values: 0 (Ignore); 1 (Only
                                  unpaired bases for just one dangling end); 2
                                  (Always use dangling energies); 3 (Allow
                                  coaxial stacking of adjacent helices))
   -adotoutfile        outfile    [*.vrnafoldpf] Vienna dotplot postscript
                                  output file
   -bdotoutfile        outfile    [*.vrnafoldpf] Vienna dotplot postscript
                                  output file
   -ssoutfile          outfile    [*.vrnafoldpf] Vienna structure postscript
                                  output file

   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin1            integer    Start of the sequence to be used
   -send1              integer    End of the sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -sformat1           string     Input sequence format
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name

   "-outfile" associated qualifiers
   -odirectory2        string     Output directory

   "-adotoutfile" associated qualifiers
   -odirectory         string     Output directory

   "-bdotoutfile" associated qualifiers
   -odirectory         string     Output directory

   "-ssoutfile" associated qualifiers
   -odirectory         string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write first file to standard output
   -filter             boolean    Read first file from standard input, write
                                  first file to standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages

>rna2
UUGGAGUACACAACCUGUACACUCUUUC

%!PS-Adobe-3.0 EPSF-3.0
%%Creator: ePS_dot.c,v 1.6 2008/06/26 08:40:00 rice Exp $, ViennaRNA-1.7.2
%%CreationDate: Sun Jul 15 12:00:00 2007
%%Title: RNA Secondary Structure Plot
%%BoundingBox: 66 210 518 662
%%DocumentFonts: Helvetica
%%Pages: 1
%%EndComments

%Options: -T 42.000000 
% to switch off outline pairs of sequence comment or
% delete the appropriate line near the end of the file

%%BeginProlog
/RNAplot 100 dict def
RNAplot begin
/fsize  14 def
/outlinecolor {0.2 setgray} bind def
/paircolor    {0.2 setgray} bind def
/seqcolor     {0   setgray} bind def
/cshow  { dup stringwidth pop -2 div fsize -3 div rmoveto show} bind def
/min { 2 copy gt { exch } if pop } bind def
/max { 2 copy lt { exch } if pop } bind def
/drawoutline {
  gsave outlinecolor newpath
  coor 0 get aload pop 0.8 0 360 arc % draw 5' circle of 1st sequence
  currentdict /cutpoint known        % check if cutpoint is defined
  {coor 0 cutpoint getinterval
   {aload pop lineto} forall         % draw outline of 1st sequence
   coor cutpoint get aload pop
   2 copy moveto 0.8 0 360 arc       % draw 5' circle of 2nd sequence
   coor cutpoint coor length cutpoint sub getinterval
   {aload pop lineto} forall}        % draw outline of 2nd sequence
  {coor {aload pop lineto} forall}   % draw outline as a whole
  ifelse
  stroke grestore
} bind def
/drawpairs {
  paircolor
  0.7 setlinewidth
  [9 3.01] 9 setdash
  newpath
  pairs {aload pop
     coor exch 1 sub get aload pop moveto
     coor exch 1 sub get aload pop lineto
  } forall
  stroke
} bind def
% draw bases
/drawbases {


  [Part of this file has been deleted for brevity]

/sequence (\
UUGGAGUACACAACCUGUACACUCUUUC\
) def
/coor [
[76.692 130.261]
[66.889 119.044]
[62.122 104.929]
[63.117 90.065]
[69.723 76.712]
[80.934 66.902]
[76.144 52.687]
[71.355 38.472]
[66.565 24.257]
[61.776 10.043]
[48.100 1.655]
[46.274 -14.284]
[57.698 -25.547]
[73.609 -23.494]
[81.802 -9.701]
[75.990 5.253]
[80.780 19.468]
[85.569 33.683]
[90.359 47.897]
[95.148 62.112]
[110.010 63.138]
[123.350 69.771]
[133.137 81.002]
[137.884 95.122]
[136.869 109.985]
[130.245 123.329]
[119.021 133.124]
[104.903 137.881]
] def
/pairs [
[6 20]
[7 19]
[8 18]
[9 17]
[10 16]
] def

init

% switch off outline pairs or bases by removing these lines
drawoutline
drawpairs
drawbases
% show it
showpage
end
%%EOF

%!PS-Adobe-3.0 EPSF-3.0
%%Title: RNA Dot Plot
%%Creator: ePS_dot.c,v 1.6 2008/06/26 08:40:00 rice Exp $, ViennaRNA-1.7.2
%%CreationDate: Sun Jul 15 12:00:00 2007
%%BoundingBox: 66 211 518 662
%%DocumentFonts: Helvetica
%%Pages: 1
%%EndComments

%Options: -T 42.000000 
% Probabilities for stacked pairs (i,j)(i+1,j-1)
%This file contains the square roots of the base pair probabilities in the form
% i  j  sqrt(p(i,j)) ubox

%%BeginProlog
/DPdict 100 dict def
DPdict begin
/logscale false def
/lpmin 1e-05 log def

/box { %size x y box - draws box centered on x,y
   2 index 0.5 mul sub            % x -= 0.5
   exch 2 index 0.5 mul sub exch  % y -= 0.5
   3 -1 roll dup rectfill
} bind def

/ubox {
   logscale {
      log dup add lpmin div 1 exch sub dup 0 lt { pop 0 } if
   } if
   3 1 roll
   exch len exch sub 1 add box
} bind def

/lbox {
   3 1 roll
   len exch sub 1 add box
} bind def

/drawseq {
% print sequence along all 4 sides
[ [0.7 -0.3 0 ]
  [0.7 0.7 len add 0]
  [-0.3 len sub -0.4 -90]
  [-0.3 len sub 0.7 len add -90]
] {
   gsave
    aload pop rotate translate
    0 1 len 1 sub {
     dup 0 moveto


  [Part of this file has been deleted for brevity]

7 17 0.003363066 ubox
7 19 0.806369320 ubox
7 21 0.571948019 ubox
8 16 0.005588458 ubox
8 18 0.867252863 ubox
9 17 0.869450272 ubox
10 16 0.765192299 ubox
10 18 0.465646147 ubox
11 17 0.474046413 ubox
12 16 0.293537313 ubox
12 18 0.006203375 ubox
13 18 0.010243061 ubox
17 22 0.004916079 ubox
17 24 0.003978294 ubox
21 25 0.003495774 ubox
21 26 0.006231260 ubox
21 27 0.006187568 ubox
1 13 0.0145421 lbox
2 10 0.0111590 lbox
2 12 0.0181003 lbox
2 17 0.0061036 lbox
2 19 0.0106114 lbox
2 21 0.0096756 lbox
3 15 0.0121334 lbox
3 16 0.0110798 lbox
3 23 0.3850400 lbox
3 24 0.0697088 lbox
3 25 0.5832047 lbox
3 26 0.0053010 lbox
3 27 0.0193731 lbox
3 28 0.0269476 lbox
4 24 0.6809466 lbox
4 26 0.0256399 lbox
4 27 0.0277023 lbox
4 28 0.0153939 lbox
5 16 0.0131388 lbox
5 23 0.6331162 lbox
5 25 0.0201391 lbox
5 26 0.0059229 lbox
5 27 0.0038129 lbox
6 14 0.0115354 lbox
6 20 0.7699092 lbox
6 22 0.5719158 lbox
7 19 0.8058871 lbox
8 18 0.8659380 lbox
9 17 0.7651279 lbox
10 18 0.4631454 lbox
11 17 0.2934067 lbox
showpage
end
%%EOF

UUGGAGUACACAACCUGUACACUCUUUC
.....(((((.....)))))........ ( -3.47)
..{(,(((((.....)))}}.}},,... [ -4.45]
.....(((((.....)))))........ { -3.47 d=4.61}
 frequency of mfe structure in ensemble 0.209182; ensemble diversity 6.08