vectorstrip

 

Wiki

The master copies of EMBOSS documentation are available at http://emboss.open-bio.org/wiki/Appdocs on the EMBOSS Wiki.

Please help by correcting and extending the Wiki pages.

Function

Removes vectors from the ends of nucleotide sequence(s)

Description

vectorstrip reads one or more nucleotide sequences and writes them out again but with any of a specified set of vector sequences removed from the 5' and 3' termini. An output file with a summary of the results if also written. The vector sequences to strip out are (typically) provided in an input file. The pair of 5' and 3' vector sequences are searched against each input sequence allowing a specified maximum level of mismatches. Each 5' hit is paired with each 3' hit and the resulting subsequences output. By default only the best match between the vector patterns and each sequence are reported. Optionally, all matches up to the specified maximum mismatch level are reported.

Usage

Here is a sample session with vectorstrip


% vectorstrip @vecseqs.list 
Removes vectors from the ends of nucleotide sequence(s)
Are your vector sequences in a file? [Y]: 
Cloning vector definition file (optional): vectors
Max allowed % mismatch [10]: 
Show only the best hits (minimise mismatches)? [Y]: 
Output file [pbluescript.vectorstrip]: vector.strip
output sequence(s) [pbluescript.fasta]: vector.fasta

Go to the input files for this example
Go to the output files for this example

Command line arguments

   Standard (Mandatory) qualifiers (* if not always prompted):
  [-sequence]          seqall     Nucleotide sequence(s) filename and optional
                                  format, or reference (input USA)
  [-[no]readfile]      toggle     [Y] Are your vector sequences in a file?
*  -vectorsfile        infile     Cloning vector definition file (optional)
   -mismatch           integer    [10] Max allowed % mismatch (Any integer
                                  value)
   -[no]besthits       boolean    [Y] Show only the best hits (minimise
                                  mismatches)?
*  -alinker            string     The 5' sequence (Any string)
*  -blinker            string     The 3' sequence (Any string)
  [-outfile]           outfile    [*.vectorstrip] Output file name
  [-outseq]            seqoutall  [.] Sequence set(s)
                                  filename and optional format (output USA)

   Additional (Optional) qualifiers:
   -allsequences       boolean    [N] Show all sequences in output

   Advanced (Unprompted) qualifiers: (none)
   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin1            integer    Start of each sequence to be used
   -send1              integer    End of each sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -sformat1           string     Input sequence format
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name

   "-outfile" associated qualifiers
   -odirectory3        string     Output directory

   "-outseq" associated qualifiers
   -osformat4          string     Output seq format
   -osextension4       string     File name extension
   -osname4            string     Base file name
   -osdirectory4       string     Output directory
   -osdbname4          string     Database name to add
   -ossingle4          boolean    Separate file for each entry
   -oufo4              string     UFO features
   -offormat4          string     Features format
   -ofname4            string     Features file name
   -ofdirectory4       string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write first file to standard output
   -filter             boolean    Read first file from standard input, write
                                  first file to standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages

Qualifier Type Description Allowed values Default
Standard (Mandatory) qualifiers
[-sequence]
(Parameter 1)
seqall Nucleotide sequence(s) filename and optional format, or reference (input USA) Readable sequence(s) Required
[-[no]readfile]
(Parameter 2)
toggle Are your vector sequences in a file? Toggle value Yes/No Yes
-vectorsfile infile Cloning vector definition file (optional) Input file Required
-mismatch integer Max allowed % mismatch Any integer value 10
-[no]besthits boolean Show only the best hits (minimise mismatches)? Boolean value Yes/No Yes
-alinker string The 5' sequence Any string  
-blinker string The 3' sequence Any string  
[-outfile]
(Parameter 3)
outfile Output file name Output file <*>.vectorstrip
[-outseq]
(Parameter 4)
seqoutall Sequence set(s) filename and optional format (output USA) Writeable sequence(s) <*>.format
Additional (Optional) qualifiers
-allsequences boolean Show all sequences in output Boolean value Yes/No No
Advanced (Unprompted) qualifiers
(none)

Input file format

Input files for usage example

File: vecseqs.list

../../data/bluescript.seq
../../data/litmus.seq
../../data/pTYB1.seq

File: vectors

# Example vector file for use by vectorstrip

# Vector	5'			3'

pTYB1   GACGGCGGCCGCGAATTCC     TCGAGGGCTCTTCCTGC
pBS_KS+ GGGTACCGGGCCCCCCC       TCGAGGTCGACGGTA         
pLITMUS GATATCCTGCAGGAATTCC     TCGAGACCGTACGTGCG

The same fragment has been cloned into the XhoI site of the polylinker of each vector. The cloned fragment is represented in lower case and the vector sequence in upper case so the sequence trimming can be readily seen.

Each line of the vector file should contain the name of the vector, the 5' pattern and the 3' pattern.
Lines beginning with # are treated as comments and ignored.
If only one vector sequence is given in the it will be assumed that this is the 5' pattern.
If a vector name is given but no pattern data, the vector will not be used.

Output file format

Output files for usage example

File: vector.strip


Sequence: pBlueScript 	 Vector: pTYB1	No match


Sequence: pBlueScript 	 Vector: pBS_KS+
5' sequence matches:
	From 67 to 83 with 0 mismatches
3' sequence matches:
	From 205 to 219 with 0 mismatches
Sequences output to file:
	from 84 to 204
		tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagca
		cacagtgacatgagagacacagatatagagacagatagacgatagacaga
		cagcatatatagacagatagc
	sequence trimmed from 5' end:
		GGAAACAGCTAATGACCATGATTACGCCAAGCGCGCAATTAACCCTCACT
		AAAGGGAACAAAAGCTGGGTACCGGGCCCCCCC
	sequence trimmed from 3' end:
		TCGAGGTCGACGGTATCGATAAGCTTGATATCG


Sequence: pBlueScript 	 Vector: pLITMUS	No match

Sequence: litmus.seq 	 Vector: pTYB1	No match

Sequence: litmus.seq 	 Vector: pBS_KS+	No match


Sequence: litmus.seq 	 Vector: pLITMUS
5' sequence matches:
	From 43 to 61 with 0 mismatches
3' sequence matches:
	From 183 to 199 with 0 mismatches
Sequences output to file:
	from 62 to 182
		tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagca
		cacagtgacatgagagacacagatatagagacagatagacgatagacaga
		cagcatatatagacagatagc
	sequence trimmed from 5' end:
		TCTAGAACCGGTGACGTCTCCCATGGTGAAGCTTGGATCCACGATATCCT
		GCAGGAATTCC
	sequence trimmed from 3' end:
		TCGAGACCGTACGTGCGCGCGAATGCATCCAGATCTTCCCTCTAGTCAAG
		GCCTTAAGTGAGTCGTATTACGGA



Sequence: pTYB1.seq 	 Vector: pTYB1
5' sequence matches:
	From 40 to 58 with 0 mismatches
3' sequence matches:
	From 180 to 196 with 0 mismatches
Sequences output to file:
	from 59 to 179
		tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagca
		cacagtgacatgagagacacagatatagagacagatagacgatagacaga
		cagcatatatagacagatagc
	sequence trimmed from 5' end:
		CTTTAAGAAGGAGATATACATATGGCTAGCTCGCGAGTCGACGGCGGCCG
		CGAATTCC
	sequence trimmed from 3' end:
		TCGAGGGCTCTTCCTGCTTTGCCAAGGGTACCAATGTTTTAATGGCGGAT


Sequence: pTYB1.seq 	 Vector: pBS_KS+	No match

Sequence: pTYB1.seq 	 Vector: pLITMUS	No match

File: vector.fasta

>pBlueScript_from_84_to_204 KS+
tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagcacacagtgaca
tgagagacacagatatagagacagatagacgatagacagacagcatatatagacagatag
c
>litmus.seq_from_62_to_182
tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagcacacagtgaca
tgagagacacagatatagagacagatagacgatagacagacagcatatatagacagatag
c
>pTYB1.seq_from_59_to_179
tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagcacacagtgaca
tgagagacacagatatagagacagatagacgatagacagacagcatatatagacagatag
c

Two types of output file are produced:

  1. The sequence file(s) - contain the trimmed subsequence(s) produced by vectorstrip either all in one file, or in separate files if the command line flag -ossingle is used.
  2. Results summary file

Data files

None.

Notes

vectorstrip is intended for stripping vector sequence from the ends of sequences of interest. For example, if a fragment has been cloned into a vector and then sequenced, the sequence may contain vector data eg from the cloning polylinker at the 5' and 3' ends of the sequence. vectorstrip will remove these contaminating regions and output trimmed sequence ready for input into another application.

vectorstrip is suitable for use with low quality sequence data as it can allow for mismatches between the sequence and the vector patterns provided. You can specify the maximum level of mismatch expected.

Vector data can either be provided in a file or interactively. If presented in a file, vectorstrip will search all input sequences with all vectors listed in that file. The intention is that the user can maintain a single file for use with vectorstrip, containing all the linker sequences commonly used in the laboratory.

The two patterns for each vector are searched separately against the sequence. Once the search is completed, each of the hits of the 5' sequence is paired with each of the hits of the 3' sequence and the resulting subsequences are output. For example, if the 5' sequence matches the sequence from (a) position 30-60, and(b)position 70-100, and the 3' sequence matches from 150-175, then two subsequences will be output: from 61-149, and from 101-149. The lower the quality of the sequence, the more likely multiple hits become if nonzero mismatches are accepted.

Default behaviour is to report only the best matches between the vector patterns and the sequence. This means that if you specify a maximum mismatch level of 10%, but the vector patterns match the sequence with zero mismatches, the search will stop and the program will output only these "best" matches. If there are no perfect matches, the program will try searching again allowing 1 mismatch, then 2, and so on until either the patterns match the sequence or the maximum specified mismatch level is exceeded. You can tell vectorstrip to show all possible matches up to your specified maximum level, as illustrated in the examples below.

References

None.

Warnings

None.

Diagnostic Error Messages

  1. No suitable vectors found - exiting
    indicates that the 5' and 3' patterns for the vectors were blank - usually this is as a result of an empty vectorfile.
  2. Illegal pattern
    indicates that one of the vector patterns could not be compiled and therefore cannot be searched.
  3. 5' and 3' sequence matches are identical; inconclusive
    indicates that the 5' and 3' patterns provided were identical, and that they only match the sequence once. Thus the program cannot determine which part of the sequence is vector and which is insert.

Exit status

It always exits with status 0.

Known bugs

None.

See also

Program name Description
aligncopy Reads and writes alignments
aligncopypair Reads and writes pairs from alignments
biosed Replace or delete sequence sections
codcopy Copy and reformat a codon usage table
cutseq Removes a section from a sequence
degapseq Removes non-alphabetic (e.g. gap) characters from sequences
descseq Alter the name or description of a sequence
entret Retrieves sequence entries from flatfile databases and files
extractalign Extract regions from a sequence alignment
extractfeat Extract features from sequence(s)
extractseq Extract regions from a sequence
featcopy Reads and writes a feature table
featreport Reads and writes a feature table
listor Write a list file of the logical OR of two sets of sequences
makenucseq Create random nucleotide sequences
makeprotseq Create random protein sequences
maskambignuc Masks all ambiguity characters in nucleotide sequences with N
maskambigprot Masks all ambiguity characters in protein sequences with X
maskfeat Write a sequence with masked features
maskseq Write a sequence with masked regions
newseq Create a sequence file from a typed-in sequence
nohtml Remove mark-up (e.g. HTML tags) from an ASCII text file
noreturn Remove carriage return from ASCII files
nospace Remove all whitespace from an ASCII text file
notab Replace tabs with spaces in an ASCII text file
notseq Write to file a subset of an input stream of sequences
nthseq Write to file a single sequence from an input stream of sequences
nthseqset Reads and writes (returns) one set of sequences from many
pasteseq Insert one sequence into another
revseq Reverse and complement a nucleotide sequence
seqret Reads and writes (returns) sequences
seqretsetall Reads and writes (returns) many sets of sequences
seqretsplit Reads sequences and writes them to individual files
sizeseq Sort sequences by size
skipredundant Remove redundant sequences from an input set
skipseq Reads and writes (returns) sequences, skipping first few
splitsource Split sequence(s) into original source sequences
splitter Split sequence(s) into smaller sequences
trimest Remove poly-A tails from nucleotide sequences
trimseq Remove unwanted characters from start and end of sequence(s)
trimspace Remove extra whitespace from an ASCII text file
union Concatenate multiple sequences into a single sequence
yank Add a sequence reference (a full USA) to a list file

Author(s)